Tumor-specific chimeric promoter and its construction method and application
A technology of chimeric promoter and construction method, which is applied in the field of construction of tumor-specific chimeric promoter, can solve the problem that the activity needs to be improved, and achieve the effects of strong activity, strong promoter activity and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Taking a tumor-specific chimeric promoter as an example, the steps of its construction method are as follows:
[0037] 1. Clone Survivin sequence
[0038] Human peripheral blood was collected, and human genomic DNA was extracted using the Micro Genomic DNA Rapid Extraction Kit of Feijie Bioreagents Co., Ltd. and the corresponding method of the kit. And design the primers for the specific promoter partial sequence of Survivin as follows:
[0039] Survivin P1: XhoI ACTCGAGCCCGGCCTGCACGCGTTC
[0040] P2: XbaIATCTAGACGGTTAATGGCGCGCCGC
[0041] Amplify by polymerase chain reaction, the volume of polymerase chain reaction is: 5 μl 10×PCR buffer, 1 μl P1, 1 μl P2, 0.5 μl LA Taq, 1 μl Genomic DNA, 1 μl 10mM dNTPs, 40.5 μl triple distilled water. Polymerase chain reaction amplification conditions: 94°C for 5 minutes, 94°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute, and the number of reaction cycles is 30 times.
[0042] Obtain the specific promoter partial s...
Embodiment 2
[0063] Taking the tumor-specific chimeric promoter expressing and amplifying tumor necrosis factor-related apoptosis-inducing ligand (Trail) vector as an example, the steps of its construction method are as follows:
[0064] 1. Clone Survivin sequence
[0065] The steps of cloning the partial sequence of the specific promoter of Survivin are the same as in Example 1, and the partial sequence of the specific promoter of Survivin is obtained.
[0066] 2. Construction of tumor-specific chimeric promoters
[0067] Construction of a novel tumor-specific chimeric promoter Survivin-miniCMV was the same as in Example 1, and a tumor-specific chimeric promoter was obtained.
[0068] 3. Construction of tumor-specific chimeric promoters expressing tumor necrosis factor-related apoptosis-inducing ligand vectors
[0069] The tumor necrosis factor-related apoptosis-inducing ligand gene was amplified by polymerase chain reaction. Polymerase chain reaction amplification conditions: 94°C for...
Embodiment 3
[0071] A tumor-specific chimeric promoter was constructed to express the E1A gene, and the E4-fiber region simultaneously expressed a small interfering RNA (siHecl) targeting a highly expressed protein in cancer, a conditionally replicable adenoviral vector.
[0072] 1. Clone Survivin sequence
[0073] The steps of cloning the partial sequence of the specific promoter of Survivin are the same as in Example 1, and the partial sequence of the specific promoter of Survivin is obtained.
[0074] 2. Construction of tumor-specific chimeric promoters
[0075] The construction of a tumor-specific chimeric promoter was the same as in Example 1, and a tumor-specific chimeric promoter was obtained.
[0076] 3. Construction of a shuttle vector expressing E1A with a tumor-specific chimeric promoter
[0077] The tumor-specific chimeric promoter was excised from pSurvivin-miniCMV by KpnI and XhoI double enzymes, purified by agarose electrophoresis with a mass concentration of 1.0%, and then ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 