Unlock instant, AI-driven research and patent intelligence for your innovation.

Tumor-specific chimeric promoter and its construction method and application

A technology of chimeric promoter and construction method, which is applied in the field of construction of tumor-specific chimeric promoter, can solve the problem that the activity needs to be improved, and achieve the effects of strong activity, strong promoter activity and good specificity

Inactive Publication Date: 2011-11-30
SHAANXI NORMAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Survivin promoter is a recently discovered tumor-specific promoter with a relatively broad spectrum of applicable cells. Studies have shown that the Survivin promoter has high activity and good specificity in a variety of tumor cells, but Its activity still needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor-specific chimeric promoter and its construction method and application
  • Tumor-specific chimeric promoter and its construction method and application
  • Tumor-specific chimeric promoter and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Taking a tumor-specific chimeric promoter as an example, the steps of its construction method are as follows:

[0037] 1. Clone Survivin sequence

[0038] Human peripheral blood was collected, and human genomic DNA was extracted using the Micro Genomic DNA Rapid Extraction Kit of Feijie Bioreagents Co., Ltd. and the corresponding method of the kit. And design the primers for the specific promoter partial sequence of Survivin as follows:

[0039] Survivin P1: XhoI ACTCGAGCCCGGCCTGCACGCGTTC

[0040] P2: XbaIATCTAGACGGTTAATGGCGCGCCGC

[0041] Amplify by polymerase chain reaction, the volume of polymerase chain reaction is: 5 μl 10×PCR buffer, 1 μl P1, 1 μl P2, 0.5 μl LA Taq, 1 μl Genomic DNA, 1 μl 10mM dNTPs, 40.5 μl triple distilled water. Polymerase chain reaction amplification conditions: 94°C for 5 minutes, 94°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute, and the number of reaction cycles is 30 times.

[0042] Obtain the specific promoter partial s...

Embodiment 2

[0063] Taking the tumor-specific chimeric promoter expressing and amplifying tumor necrosis factor-related apoptosis-inducing ligand (Trail) vector as an example, the steps of its construction method are as follows:

[0064] 1. Clone Survivin sequence

[0065] The steps of cloning the partial sequence of the specific promoter of Survivin are the same as in Example 1, and the partial sequence of the specific promoter of Survivin is obtained.

[0066] 2. Construction of tumor-specific chimeric promoters

[0067] Construction of a novel tumor-specific chimeric promoter Survivin-miniCMV was the same as in Example 1, and a tumor-specific chimeric promoter was obtained.

[0068] 3. Construction of tumor-specific chimeric promoters expressing tumor necrosis factor-related apoptosis-inducing ligand vectors

[0069] The tumor necrosis factor-related apoptosis-inducing ligand gene was amplified by polymerase chain reaction. Polymerase chain reaction amplification conditions: 94°C for...

Embodiment 3

[0071] A tumor-specific chimeric promoter was constructed to express the E1A gene, and the E4-fiber region simultaneously expressed a small interfering RNA (siHecl) targeting a highly expressed protein in cancer, a conditionally replicable adenoviral vector.

[0072] 1. Clone Survivin sequence

[0073] The steps of cloning the partial sequence of the specific promoter of Survivin are the same as in Example 1, and the partial sequence of the specific promoter of Survivin is obtained.

[0074] 2. Construction of tumor-specific chimeric promoters

[0075] The construction of a tumor-specific chimeric promoter was the same as in Example 1, and a tumor-specific chimeric promoter was obtained.

[0076] 3. Construction of a shuttle vector expressing E1A with a tumor-specific chimeric promoter

[0077] The tumor-specific chimeric promoter was excised from pSurvivin-miniCMV by KpnI and XhoI double enzymes, purified by agarose electrophoresis with a mass concentration of 1.0%, and then ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a tumor distinctive embedment promoter comprising a tumor distinctive promoter Survivin sequence with any basic group of 1-233 positions in an basic group sequence shown by NO1 in a nucleotide sequence table and a miniCMV sequence with any basic group of 1-62 positions in the basic group sequence shown by NO2 in the nucleotide sequence table, wherein the tumor distinctivepromoter Survivin sequence is at the 5' end, the miniCMV sequence is at the 3' end, and the sequence has any basic group of 1-313 positions in the basic group sequence shown by NO3 in the nucleotide sequence table. The constructing method of the tumor distinctive embedment promoter comprises two steps of cloning the Survivin sequence and constructing the tumor distinctive embedment promoter. The invention also provides an application of the tumor distinctive embedment promoter in expressing small-interfering RNA or constructing a conditional reproduction type adenovirus carrier or expressing tumor treating genes.

Description

technical field [0001] The invention belongs to the technical field of gene therapy and virus therapy, and in particular relates to the construction of a tumor-specific chimeric promoter. Background technique [0002] Malignant tumors seriously threaten human life and health. At present, the conventional treatment for malignant tumors is still surgery, radiotherapy, and chemotherapy. The curative effect of this conventional treatment on most tumors is still not very satisfactory. For most chemotherapy drugs, its therapeutic index is still very low, that is, its The therapeutic dose is close to the toxic dose. Therefore, this treatment is usually accompanied by significant toxic effects. Therefore, the research on the method of selectively killing tumor cells mainly depends on the specific markers of tumor cells, and the targeted therapy of tumors has become a research hotspot at present. In recent years, with the rapid development of biotechnology, tumor gene therapy has ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12P19/34C12N15/85C12N15/861A61K48/00A61P35/00C12N15/113
Inventor 夏海滨张伟锋王东阳郑晓晶赵俊丽
Owner SHAANXI NORMAL UNIV