Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for amplifying NK cells of human beings under condition of in vitro culture

A NK cell, in vitro expansion technology, applied in the field of immunology and molecular biology, can solve the problems of NK cell clinical application limitations, lack of in vitro expansion system, expansion effect can not meet the actual application and other problems, to achieve the expansion multiple The effect of increasing, killing activity and expression level

Inactive Publication Date: 2010-03-31
JIANGMEN LUOSEN BIO PHARMA
View PDF0 Cites 51 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this expansion effect still cannot meet the practical application. Generally speaking, there is still a lack of effective in vitro expansion system, so the clinical application of NK cells is severely limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0009] Example 1: Cloning of CD8α chain transmembrane region gene.

[0010] In order to express IL-2, IL-12, IL-15, and IL-18 cytokines in the outer membrane of K562 cells in the form of membrane proteins, the extracellular parts of these cytokines were first combined with the CD8α chain transmembrane region gene fusion.

[0011] The complete CD8α chain transmembrane region gene (CD8tm) is:

[0012] ggatcctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactggttatcaccctttatgctaagcggccgc

[0013] CD8tm is synthesized from the following two nucleotide chains:

[0014] CD8F: 5' tcggatcctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactgg 3'

[0015] CD8R: 5'atgcggccgcttagcagtaaagggtgataaccagtgacaggagaaggaccccacaagtcccgg 3'

[0016] These two nucleotide chains were annealed and extended to obtain a complete CD8α chain transmembrane region gene, and the 5' end and 3' end of the gene were respectively introduced with BamHI and NotI restriction sites. Using these two restriction si...

Embodiment 2

[0017] Example 2: Expression of IL-2, IL-12, IL-15 and IL-18 genes on K562 cell membrane.

[0018] RT-PCR method was used to extract mRNA from human PBMC, and to amplify the cDNA of IL-2, IL-12, IL-15 and IL-18.

[0019] The upstream primer for amplifying IL-2 is IL-2F: 5'tcgctagcatgtacaggatgcaactcctg3', the downstream primer is IL-2R: 5'tcggatccagtcagtgttgagatgatgc3', NheI and BamHI restriction sites were introduced into the upstream and downstream primers respectively;

[0020] The upstream primer for amplifying IL-12 is IL-12F: 5'tagctagcatgtggccccctgggtcagcct 3', the downstream primer is IL-12R: 5'tcggatccggaagcattcagatagctc 3', NheI and BamHI restriction sites were introduced into the upstream and downstream primers respectively;

[0021] The upstream primer for amplifying IL-15 is IL-15F: 5'tcgctagcatgagaatttcgaaaccacatttgag3', the downstream primer is IL-15R: 5'tcggatccagaagtgttgatgaacatttggac3', NheI and BamHI restriction sites were introduced into the upstream and dow...

Embodiment 3

[0061] Example 3: Expression of 4-1BBL gene on K562 cell membrane.

[0062] 4-1BBL itself is a transmembrane protein, it does not need to be fused with the CD8α chain transmembrane region gene, and can be directly cloned into the pcDNA3.1+ / Neo eukaryotic expression vector. The amplification of the 4-1BBL gene is the same as the above-mentioned cytokine amplification, and its mRNA is also obtained from human PBMC by RT-PCR. The upstream primer for amplifying 4-1BBL is 4-1BB-F: 5'tcgctagcatggaatacgcctctgacgcttcac 3', the downstream primer is 4-1BB-R: 5'tcggatccttatccgacctcggtgaagggag 3', NheI and BamHI restriction sites were introduced into the upstream and downstream primers respectively point; the amplified 4-1BBL cDNA was double digested with NheI and BamHI and cloned into pcDNA3.1+ / Neo vector, then transfected into K562 cells respectively, single cloned cells were screened with G418, identified by antibody staining, and finally transfected K562 engineered cells expressing 4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for amplifying NK cells of human beings under the condition of in vitro culture, which is characterized in that a peripheral blood mononuclear cell (PBMC) is taken asthe original culturing material, and the PBMC is cultured together with an engineering cell which is built by adopting the genetic engineering method and is used for stimulating the growth of the NK cell. The built engineering cell which is used for stimulating the growth of the NK cell expresses several cytokines (IL-2, IL-12, IL-15, IL-18, 4-1BB) which can promote the growth of the NK cell on the surface of the K562 cell; after irradiation and inactivation with gamma-rays, the engineering cell is cultured with the PBMC in vitro, as a result, the amplification effect of the stimulation methodin the invention is hundreds of times stronger than that of the currently universal method in which soluble cytokines are added purely to the culture solution; and after cultured for 3 weeks, the non-NK cells in the PBMC are mainly dead and disappeared, the NK cells are proliferated in great quantity, the purity of the NK cells reaches over 96% and the total number of the NK cells is amplified byover 1500 times.

Description

technical field [0001] The invention relates to the fields of immunology and molecular biology, in particular to a method for expanding human NK cells under in vitro culture conditions which can effectively improve the purity and killing activity of NK cells. Background technique [0002] NK (natural killer, natural killer) cells are important immune cells in the body and play an important role in anti-tumor and anti-viral infection immunity. Since the killing activity of NK cells is not limited by MHC, it is called natural killer. The target cells of NK cells are mainly tumor cells, virus-infected cells, some self-organized cells (such as blood cells), parasites, etc. Therefore, NK cells are an important part of the body's anti-tumor and anti-infection immunity. Due to these characteristics, NK cells have broad application prospects in cellular immunotherapy. However, the content of NK cells in human peripheral blood is seldom (accounting for about 5%-20% of lymphocytes),...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/0783C12N5/10
Inventor 张明杰
Owner JIANGMEN LUOSEN BIO PHARMA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More