Method for amplifying NK cells of human beings under condition of in vitro culture
A NK cell, in vitro expansion technology, applied in the field of immunology and molecular biology, can solve the problems of NK cell clinical application limitations, lack of in vitro expansion system, expansion effect can not meet the actual application and other problems, to achieve the expansion multiple The effect of increasing, killing activity and expression level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0009] Example 1: Cloning of CD8α chain transmembrane region gene.
[0010] In order to express IL-2, IL-12, IL-15, and IL-18 cytokines in the outer membrane of K562 cells in the form of membrane proteins, the extracellular parts of these cytokines were first combined with the CD8α chain transmembrane region gene fusion.
[0011] The complete CD8α chain transmembrane region gene (CD8tm) is:
[0012] ggatcctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactggttatcaccctttatgctaagcggccgc
[0013] CD8tm is synthesized from the following two nucleotide chains:
[0014] CD8F: 5' tcggatcctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactgg 3'
[0015] CD8R: 5'atgcggccgcttagcagtaaagggtgataaccagtgacaggagaaggaccccacaagtcccgg 3'
[0016] These two nucleotide chains were annealed and extended to obtain a complete CD8α chain transmembrane region gene, and the 5' end and 3' end of the gene were respectively introduced with BamHI and NotI restriction sites. Using these two restriction si...
Embodiment 2
[0017] Example 2: Expression of IL-2, IL-12, IL-15 and IL-18 genes on K562 cell membrane.
[0018] RT-PCR method was used to extract mRNA from human PBMC, and to amplify the cDNA of IL-2, IL-12, IL-15 and IL-18.
[0019] The upstream primer for amplifying IL-2 is IL-2F: 5'tcgctagcatgtacaggatgcaactcctg3', the downstream primer is IL-2R: 5'tcggatccagtcagtgttgagatgatgc3', NheI and BamHI restriction sites were introduced into the upstream and downstream primers respectively;
[0020] The upstream primer for amplifying IL-12 is IL-12F: 5'tagctagcatgtggccccctgggtcagcct 3', the downstream primer is IL-12R: 5'tcggatccggaagcattcagatagctc 3', NheI and BamHI restriction sites were introduced into the upstream and downstream primers respectively;
[0021] The upstream primer for amplifying IL-15 is IL-15F: 5'tcgctagcatgagaatttcgaaaccacatttgag3', the downstream primer is IL-15R: 5'tcggatccagaagtgttgatgaacatttggac3', NheI and BamHI restriction sites were introduced into the upstream and dow...
Embodiment 3
[0061] Example 3: Expression of 4-1BBL gene on K562 cell membrane.
[0062] 4-1BBL itself is a transmembrane protein, it does not need to be fused with the CD8α chain transmembrane region gene, and can be directly cloned into the pcDNA3.1+ / Neo eukaryotic expression vector. The amplification of the 4-1BBL gene is the same as the above-mentioned cytokine amplification, and its mRNA is also obtained from human PBMC by RT-PCR. The upstream primer for amplifying 4-1BBL is 4-1BB-F: 5'tcgctagcatggaatacgcctctgacgcttcac 3', the downstream primer is 4-1BB-R: 5'tcggatccttatccgacctcggtgaagggag 3', NheI and BamHI restriction sites were introduced into the upstream and downstream primers respectively point; the amplified 4-1BBL cDNA was double digested with NheI and BamHI and cloned into pcDNA3.1+ / Neo vector, then transfected into K562 cells respectively, single cloned cells were screened with G418, identified by antibody staining, and finally transfected K562 engineered cells expressing 4...
PUM
Property | Measurement | Unit |
---|---|---|
purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap