Recombinant yeast for expressing antibody or antibody analogue as well as construction method and application thereof

An antibody analog, yeast technology, applied in microorganism-based methods, biochemical equipment and methods, recombinant DNA technology, etc., can solve the problems of high antibody drug treatment, high culture cost, etc.

Inactive Publication Date: 2010-06-23
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the expression level of mammalian cells has been greatly improved in recent years, the high cost of culture of mammalian cells and the limitation of culture scale still severely restrict the development of this type of drug, which is also the main reason for the high price of antibody drug treatment. reason

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant yeast for expressing antibody or antibody analogue as well as construction method and application thereof
  • Recombinant yeast for expressing antibody or antibody analogue as well as construction method and application thereof
  • Recombinant yeast for expressing antibody or antibody analogue as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Expression of anti-HER2 humanized monoclonal antibody in Pichia pastoris

[0039] 1. Obtaining the whole gene of anti-HER2 humanized monoclonal antibody

[0040] According to the light and heavy chain sequences of anti-HER2 humanized antibodies reported on Genbank (Genbank: AAB49171.4, and AAB48814.1) and the preferred codons of Pichia pastoris, the genes for the light and heavy chains were designed. The nucleotide sequence of the light chain is sequence 3 in the sequence listing, and the nucleotide sequence of the heavy chain is sequence 4 in the sequence listing.

[0041] Use the one-step PCR method to design primers, that is, the gene is divided into two sections, the first section is segmented to synthesize a 59bp forward fragment, and each segment overlaps by 20bp, and the latter segment is segmented to synthesize a 59bp reverse fragment. 1pmol, mixed, head-to-tail primers as forward and reverse primers, PCR amplified spliced ​​gene to obtain light chai...

Embodiment 2

[0112] Example 2, Expression of anti-Her2 humanized antibody in Kluyveromyces lactis

[0113] 1. Acquisition of light chain and heavy chain genes of anti-HER2 humanized antibody containing different signal peptides

[0114] Using the vector pPIC9-HL constructed in Example 1, PCR amplifies the antibody heavy chain gene H (Heavy chain) fragment containing the HSA signal peptide, and the primer is HSA-KL-01 (5'-CG ACTAGT CAAACGATGAAGTGGGTAACCTTTATTTCCCTTCTTTTTCTCTTTAGCTCGGC-3', the underlined part is the SpeI restriction site) and primer Her2-03: (5'-CG GCGGCCGC TTACTTACCTGGAGACAAAGACAAAG-3', the underlined part is the NotI restriction site).

[0115] The PCR reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 2 min, and a total of 30 cycles, with a final extension at 72°C for 10 min.

[0116] The PCR product was recovered by a DNA fragment purification recovery kit.

[0117] Using...

Embodiment 3

[0186] Example 3, Expression of Antibody Analog sTNFRII-IgGFc in Pichia pastoris

[0187] 1. sTNFRII-IgGFc fusion protein gene cloning

[0188]Take acid citrate dextrose (ACD) anticoagulant venous blood from healthy people, dilute it with Hanks solution, centrifuge with lymphocyte separation medium to obtain lymphocytes, adjust the number of cells with 1640 medium containing 10% fetal calf serum (Hyclone company) 5×10 6 cells / mL, placed in a cell incubator and incubated for 2 hours, replaced with lipopolysaccharide (LPS, 20 μg / mL) (Sigma Company) and 10% fetal bovine serum 1640 fresh medium, continued to cultivate for 5 hours, and centrifuged to enrich the cells; Total RNA was extracted by TRIzol (Shanghai Sangon Bioengineering Technology Service Co., Ltd.) method (operated according to the instructions of TRIzol); the total RNA was reverse-transcribed to obtain cDNA (RT-PCR kit, Shanghai Sangon Bioengineering Technology Service Co., Ltd., according to Kit instructions to op...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Relative molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses recombinant yeast for expressing an antibody or an antibody analogue as well as a construction method and application thereof. In the construction method of the recombinant yeast for expressing the antibody or the antibody analogue, an encoding gene of the antibody or an encoding gene of the antibody analogue is introduced in a yeast to obtain a recombinant bacterium; the antibody analogue is a fusion protein formed by an Fc fragment of the antibody and a protein or a protein subunit; the encoding gene of the antibody is a heavy chain encoding gene and a light chain encoding gene of the antibody, and the 5' end of the encoding gene of the antibody or the encoding gene of the antibody analogue is connected with an encoding signal peptide nucleotide sequence; and signal peptide is serum albumin signal peptide. By utilizing the recombinant yeast for expressing the antibody or the antibody analogue to prepare the antibody and the antibody analogue, the invention can solve the bottlenecks of difficult antibody production, requirements of high product purity and large amount and the like and can also exert the functions provided by the antibody Fc fragment, thereby having a favorable application potential.

Description

technical field [0001] The invention relates to a recombinant yeast expressing an antibody or an antibody analogue, a construction method and application thereof. Background technique [0002] Genetically engineered antibodies and antibody analog drugs are one of the fastest growing drugs in recent years. Such drugs are often used in relatively large doses, ranging from tens to hundreds of milligrams per dose, and a patient needs a gram-level amount of antibody drugs for a course of treatment, so there is a huge market demand for them. Antibody drugs are a class of proteins with complex structures. Its monomers are symmetrical molecules. One heavy chain and one light chain are bound together by an intermolecular disulfide bond and a non-covalent bond. Covalent bonds and one or more disulfide bonds join together to form antibody monomers. Some antibody molecules are composed of one monomer, such as IgG, and some antibodies can be connected by multiple monomers to form multi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12P21/08C07K16/00C12R1/645C12R1/84
Inventor刘波吴军王凌雪巩新唱韶红
OwnerINST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE