Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors

A signal regulation protein and vaccine technology, applied in the field of medical bioengineering, can solve the problems of application limitations, short half-life of siRNA, short-term inhibition, etc., and achieve the effect of improving DC activation level and antigen presentation function

Inactive Publication Date: 2010-07-21
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the poor transfection effect of liposomes in some types of cells, the half-life of siRNA transferred into cells is short, and the inhibitory effect of siRNA synthesized in vitro on gene expression is usually short-lived, so its application is greatly limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors
  • Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors
  • Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction and identification of lentiviral expression plasmids and lentiviral packaging and infection

[0035] 1. Construction and identification of lentiviral vector

[0036] Material:

[0037] 1) The primer sequence of microRNA interference SIRPα:

[0038] upstream

[0039] TGCTGTCTATGAGCAGATGAGTTCACGTTTTGGCCACTGACTGACGTGAACTCCTGCTCATAGA,

[0040] downstream

[0041] CCTGTCTATGAGCAGGAGTTCACGTCAGTCAGTGGCCAAAACGTGAACTCATCTGCTCATAGAC was entrusted to Shanghai Sangong Synthesis.

[0042] 2) The linearized vector pcDNA6.2-GW / miR and the packaging vectors pLP1, pLP2, and pLP / VSVG were purchased from Invitrogen.

[0043] 3) Endonucleases spe1, BamH1, and Nhe1 were purchased from MBI, and T4 ligase and Buffer were purchased from Invitrogen.

[0044] 4) 293T cell line, purchased from Chinese Academy of Sciences.

[0045] 5) Calcium phosphate transfection reagent (see molecular cloning for details).

[0046] 6) C57 mice, male, 6 weeks old, purchased from C...

Embodiment 2

[0061] Example 2: Relationship between SIRPα and DC survival

[0062] Material

[0063] 1) LPS, purchased from TAKARA.

[0064] 2) PI, purchased from Invitrogen.

[0065] method

[0066] In order to verify that the down-regulation of SIRPα expression is related to the enhancement of DC viability, BMDCs were cultured on the fifth day and passed 2×10 6 / well to a 6-well plate, adding lentivirus infection to interfere with SIRPα expression and the control group. After 24h, miSIRPα-DC, GFP-DC and PBS-DC in each group were cultured in the absence of GM-CSF, and the cells were collected on 1d, 2d, 3d and 4d, 1×10 5 DCs were resuspended with 100 μl of ice-precooled NaCl and then added to PI. After staining at 4 degrees for 5 minutes, the samples were loaded on a flow cytometer and the differential staining of PI was detected.

[0067] result

[0068] The result is as figure 2 As shown, when cultured without GM-CSF, the death rate (PI+) of DCs with down-regulated SIRPα express...

Embodiment 3

[0070] Example 3: Relationship between SIRPα and DC phenotype and functional maturation

[0071] Material

[0072] 1) Anti-mouse PE-MHC, PE-CD80, PE-CD86 were purchased from biolegend.

[0073] 2) Mouse IL-12, IL-6 and TNF-α ELISA detection kits were purchased from Daktronics Company.

[0074] method

[0075] 1) Expression of MHC and co-stimulatory molecules

[0076] First, after 60 hours of lentivirus infection, the cell morphology was photographed by a light microscope at 400×. Then collect 1×10 5 DCs of each group (miSIRPα-DC, GFP-DC and PBS-DC) were resuspended with 100 μl of ice-cold NaCl+2% FBS buffer, added with PE-labeled MHC II, CD80 and CD86, and incubated at 4 degrees for 30 minutes Afterwards, the residual antibody was washed away with ice-cold NaCl, and the samples were loaded on a flow cytometer to detect the differential staining of PE.

[0077] 2) Function of secreting cytokines

[0078]After 60 hr of lentivirus infection, DC culture supernatants of each...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of medical bio-engineering, and particularly relates to new application of the signal adjusting protein alpha(SIRP alpha). The signal adjusting protein alpha(SIRP alpha) belongs to a member of the immunoglobulin super family(IGSF). In-vitro biological experiments and in-vivo animal experiments prove that in the application of the signal adjusting protein alpha(SIRP alpha) in the preparation of the DC vaccine for preventing and treating tumors of the invention, the SIRP alpha signal path negatively regulates the activity and antigen presentation functions of the DC. The invention further constructs a tumor DC vaccine which can interfere with the SIRP alpha expression by the mediation of a lentiviral vector, and the tumor DC vaccine can obviously improve the DC activation level and the antigen presentation function of the DC and be used for preventing and treating mouse tumors and is a novel tumor vaccine. The invention provides a new idea for clinical treatment application of the SIRP alpha.

Description

technical field [0001] The invention belongs to the technical field of medical bioengineering. Specifically, the present invention relates to a signal regulatory protein α (SIRPα), which is used to prepare a tumor DC vaccine mediated by a lentiviral vector that interferes with the expression of SIRPα, and to prevent and treat tumors with the vaccine. Background technique [0002] Signal regulatory protein alpha (SIRPα) is a member belonging to the immunoglobulin superfamily (IgSF). Rat protein tyrosine phosphatase SIRPα was first identified in MOLECULAR AND CELLULAR BIOLOGY in 1996 and NATURE in 1997. SIRPα, also called SHPS1, CD172a, P84, is a membrane protein mainly expressed in myeloid cells, GeneID: 19261. The extracellular domain of SIRPα contains three immunoglobulin superfamily (IgSF) domains and multiple glycosylation sites. Its cytoplasmic region is highly conserved among rats, mice and humans, with two immunoreceptor tyrosine inhibitory motifs (ITIMs, whose char...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61P35/00C12N15/867C12N15/113C12N5/10
Inventor王红阳鄢和新刘琼唐亮
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY