Application of signal adjusting protein alpha in preparation of DC vaccine for preventing and treating tumors
A signal regulation protein and vaccine technology, applied in the field of medical bioengineering, can solve the problems of application limitations, short half-life of siRNA, short-term inhibition, etc., and achieve the effect of improving DC activation level and antigen presentation function
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction and identification of lentiviral expression plasmids and lentiviral packaging and infection
[0035] 1. Construction and identification of lentiviral vector
[0036] Material:
[0037] 1) The primer sequence of microRNA interference SIRPα:
[0038] upstream
[0039] TGCTGTCTATGAGCAGATGAGTTCACGTTTTGGCCACTGACTGACGTGAACTCCTGCTCATAGA,
[0040] downstream
[0041] CCTGTCTATGAGCAGGAGTTCACGTCAGTCAGTGGCCAAAACGTGAACTCATCTGCTCATAGAC was entrusted to Shanghai Sangong Synthesis.
[0042] 2) The linearized vector pcDNA6.2-GW / miR and the packaging vectors pLP1, pLP2, and pLP / VSVG were purchased from Invitrogen.
[0043] 3) Endonucleases spe1, BamH1, and Nhe1 were purchased from MBI, and T4 ligase and Buffer were purchased from Invitrogen.
[0044] 4) 293T cell line, purchased from Chinese Academy of Sciences.
[0045] 5) Calcium phosphate transfection reagent (see molecular cloning for details).
[0046] 6) C57 mice, male, 6 weeks old, purchased from C...
Embodiment 2
[0061] Example 2: Relationship between SIRPα and DC survival
[0062] Material
[0063] 1) LPS, purchased from TAKARA.
[0064] 2) PI, purchased from Invitrogen.
[0065] method
[0066] In order to verify that the down-regulation of SIRPα expression is related to the enhancement of DC viability, BMDCs were cultured on the fifth day and passed 2×10 6 / well to a 6-well plate, adding lentivirus infection to interfere with SIRPα expression and the control group. After 24h, miSIRPα-DC, GFP-DC and PBS-DC in each group were cultured in the absence of GM-CSF, and the cells were collected on 1d, 2d, 3d and 4d, 1×10 5 DCs were resuspended with 100 μl of ice-precooled NaCl and then added to PI. After staining at 4 degrees for 5 minutes, the samples were loaded on a flow cytometer and the differential staining of PI was detected.
[0067] result
[0068] The result is as figure 2 As shown, when cultured without GM-CSF, the death rate (PI+) of DCs with down-regulated SIRPα express...
Embodiment 3
[0070] Example 3: Relationship between SIRPα and DC phenotype and functional maturation
[0071] Material
[0072] 1) Anti-mouse PE-MHC, PE-CD80, PE-CD86 were purchased from biolegend.
[0073] 2) Mouse IL-12, IL-6 and TNF-α ELISA detection kits were purchased from Daktronics Company.
[0074] method
[0075] 1) Expression of MHC and co-stimulatory molecules
[0076] First, after 60 hours of lentivirus infection, the cell morphology was photographed by a light microscope at 400×. Then collect 1×10 5 DCs of each group (miSIRPα-DC, GFP-DC and PBS-DC) were resuspended with 100 μl of ice-cold NaCl+2% FBS buffer, added with PE-labeled MHC II, CD80 and CD86, and incubated at 4 degrees for 30 minutes Afterwards, the residual antibody was washed away with ice-cold NaCl, and the samples were loaded on a flow cytometer to detect the differential staining of PE.
[0077] 2) Function of secreting cytokines
[0078]After 60 hr of lentivirus infection, DC culture supernatants of each...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com