Plant promoter related to photoperiod and application thereof
A promoter and photoperiod technology, applied in the fields of application, plant products, botanical equipment and methods, etc., can solve the problems that hinder the adaptability of soybean varieties, achieve the effects of reducing metabolic burden, increasing crop yield, and improving adaptability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1, the acquisition of promoter GmRAV sequence
[0042] 1. Extraction of total plant DNA
[0043] Soybean (Glycine max (L.) Merri ll.) late-maturing variety Dongnong L13, with unlimited pod formation habit, was cultivated in a light incubator at 25°C with 250 μmol m -2 sec -1 White light, grow under long daylight (LD) (16h / 8h light / dark) conditions, cut the third three-out compound leaf, and extract soybean total DNA according to the CTAB method;
[0044] 2. Primer design: Design primers downstream of the 5' flanking sequence. The specific primer sequences are shown in Table 1.
[0045] Table 1. Primer sequences and degenerate primers at different positions
[0046] Primer position (from ATG) and name
Primer sequence (5'→3')
G1:448
GGCGGCTTCGTCTTCCTCGTT
G3:153
TGTGAAGTGAGTGCAGATAAGGGT
G4:62
GGAAGAAACAGAGAGAAACTTGAGAA
degenerate primer
CAWCGICNGAIASGAA
[0047] 3. The process of Tail-PCR re...
Embodiment 2
[0055] Embodiment 2, the function of promoter
[0056] The GUS gene is the trans-β-glucuronidase gene.
[0057] Genetic resource name: seeds of soybean (Glycine max (L.) Merrill.) variety Dongnong L13. Ways to obtain genetic resources: I. Genetic resources are obtained from: plants, II. Acquisition methods: gift (purchase / gift or exchange / preservation institution / seed bank (germplasm bank) / gene library / self-collection / commissioned collection / others) . Direct source: Obtained in October 2006; non-acquisition method, provider’s name or name: Soybean Science Research Institute of Northeast Agricultural University, provider’s country or region: Heilongjiang Province, China, provider’s contact information 0451-55190484, Harbin, China 59 Timber Street, City. The original source is unclear.
[0058] Seeds of soybean (Glycine max (L.) Merrill.) variety Dongnong L13 (Lin Zhao, Qiulan Luo, Chunli yang Yang, Yingpeng Han, Wenbin Li (2008) A RAV-like transcription factor controls phot...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap