Cellulase-producing fungus agent and application thereof
A cellulase and bacterial agent technology, applied in the application, enzyme, enzyme and other directions, can solve the problems of equipment and equipment, high floor space, long fermentation cycle, requirements and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0044] Embodiment 1, produce the bacterial agent of cellulase
[0045] 1. Cloning of the endoglucanase gene
[0046] Bacillus amyloliquefaciens CICC 22947 was cultured in LB medium (0.5g / 100ml yeast extract, 1.0g / 100ml peptone, 1.0g / 100ml NaCl, pH7.0) for 12h to obtain fresh bacterial liquid of Bacillus amyloliquefaciens. Bacteria solution carries out bacterium solution PCR amplification endoglucanase gene, and the nucleotide sequence of used primer is as follows:
[0047]5' Primer P1: GAATTC GCAGGGACAAAAAACGCCA (the underline is the EcoR I recognition site);
[0048] 3' Primer P2: GCGGCCGC CTAATTTGGTTCTGTTCCCC (Not I recognition site underlined, stop codon in italics).
[0049] The PCR reaction system is as follows:
[0050] Bacillus amyloliquefaciens CICC 22947 bacteria liquid 1ul
[0051] P1 1ul
[0052] P2 1ul
[0053] 10×PCR buffer 2.5μL
[0054] Taq Plus (Beijing Tiangen) 1ul
[0055] dNTP mix (2.5mmol / L) 4μL
[0056] wxya 2 O 14.5 μL
[0057] ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com