Detection method of infectious spleen and kidney necrosis virus Nest-PCR and kit thereof

A technology of spleen-kidney necrosis virus and detection method, which is applied in the detection field of infectious spleen-kidney necrosis virus Nest-PCR, can solve the problems of low specificity and low detection sensitivity, achieve high sensitivity, strong specificity, and shorten detection time Effect

A technology of spleen-kidney necrosis virus and detection method, which is applied in the detection field of infectious spleen-kidney necrosis virus Nest-PCR, can solve the problems of low specificity and low detection sensitivity, achieve high sensitivity, strong specificity, and shorten detection time Effect

CN101956022AInactive Publication Date: 2011-01-26CHINESE ACAD OF INSPECTION & QUARANTINE

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of infectious spleen and kidney necrosis virus Nest-PCR and kit thereof
  • Detection method of infectious spleen and kidney necrosis virus Nest-PCR and kit thereof
  • Detection method of infectious spleen and kidney necrosis virus Nest-PCR and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1) 100mg of spleen and kidney tissues of infected and dying mandarin fish were suspended in 1ml of 1×PBS, and homogenized on ice.

[0033] 2) Centrifuge at 8000 rpm for 10 minutes at low temperature.

[0034] 3) Put the supernatant into a centrifuge tube, add 500 μl Tris saturated phenol and 500 μl chloroform:isoamyl alcohol (24:1). Mix well.

[0035] 4) 12000rpm, 10min.

[0036] 5) Aspirate the supernatant. Be careful not to aspirate the middle and lower layers to avoid mixing in protein contamination.

[0037] 6) Add one-tenth volume of NaAc, 1ml of absolute ethanol, mix well, and store at -20°C for 30min.

[0038] 7) 12000rpm, 10min.

[0039] 8) The supernatant was discarded, and the precipitate was washed twice with 70% ethanol, each time at 12000 rpm for 5 min.

[0040] 9) At room temperature, air-dry until semi-dry, and dissolve in 50 μl of water.

[0041] 10) Store at -20°C for later use.

Embodiment 2

[0043] 1) 1ml GF cell suspension with complete CPE, freeze-thawed 3 times.

[0044] 2) Centrifuge at 8000 rpm for 10 minutes at low temperature.

[0045] 3) Put the supernatant into a centrifuge tube, add 500 μl Tris saturated phenol and 500 μl chloroform:isoamyl alcohol (24:1). Mix well.

[0046] 4) 12000rpm, 10min.

[0047] 5) Aspirate the supernatant. Be careful not to aspirate the middle and lower layers to avoid mixing in protein contamination.

[0048] 6) Add one-tenth volume of NaAc, 1ml of absolute ethanol, mix well, and store at -20°C for 30min.

[0049] 7) 12000rpm, 10min.

[0050]8) The supernatant was discarded, and the precipitate was washed twice with 70% ethanol, each time at 12000 rpm for 5 min.

[0051] 9) At room temperature, air-dry until semi-dry, and dissolve in 50 μl of water.

[0052] 10) Store at -20°C for later use.

Embodiment 3

[0054] 1) 100mg of spleen and kidney tissue of infected and dying American redfish, suspended in 1ml 1×PBS, and homogenized on ice.

[0055] 2) Centrifuge at 8000 rpm for 10 minutes at low temperature.

[0056] 3) Put the supernatant into a centrifuge tube, add 500 μl Tris saturated phenol and 500 μl chloroform:isoamyl alcohol (24:1). Mix well.

[0057] 4) 12000rpm, 10min.

[0058] 5) Aspirate the supernatant. Be careful not to aspirate the middle and lower layers to avoid mixing in protein contamination.

[0059] 6) Add one-tenth volume of NaAc, 1ml of absolute ethanol, mix well, and store at -20°C for 30min.

[0060] 7) 12000rpm, 10min.

[0061] 8) The supernatant was discarded, and the precipitate was washed twice with 70% ethanol, each time at 12000 rpm for 5 min.

[0062] 9) At room temperature, air-dry until semi-dry, and dissolve in 50 μl of water.

[0063] 10) Store at -20°C for later use.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method of an infectious spleen and kidney necrosis virus Nest-PCR, which comprises the following steps of using total DNA of infected host spleen and kidney or sensitive clone as a template and using a standard substance as a positive control, carrying out a first round of PCR (Polymerase Chain Reaction) by using external inducers P1 TTACAGGATAGGGAAGCC and P2 ATGTCTGAATCTCAGGTGC, carrying out a round of PCR amplification by using products of the first round of PCR as the template and using internal inducers P3 ATGCTGGGCGCAAAGTAGTAG and P4 CGCGTCTACCTTAATTTGCCC, and detecting PCR products by agarose gel electrophoresis. The invention has the advantages of high detection specificity, high sensitivity, short detection time and simple operation.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a Nest-PCR detection method for infectious spleen and kidney necrosis virus. Background technique [0002] Infectious spleen and kidney necrosis virus (ISKNV) belongs to the genus Megalocytivirus of the family Iridoviridae (Chinchar et al., 2005). He Jianguo et al. (2001) determined the whole genome sequence of ISKNV (AF371960), which is the first virus of the genus mammocytovirus whose whole genome was determined. The ISKNV genome is about 110kb in size, with a highly methylated cytosine 5' end, and contains 124 open reading frames (ORFs), of which 35 ORFs have significant homology with other types of iridescent viruses in protein composition Sex (He et al., 2001). [0003] ISKNV is highly contagious and pathogenic, and there are no effective control measures and drugs. Therefore, it is urgent to establish an effective diagnosis system, take preventive measures, eliminate the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
26 Jan 2011
Publication
CN101956022A
IPC
C12Q1/70; C12Q1/68; C12N15/11
Inventors
张旻; 江育林