Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

54 results about "Kidney necrosis" patented technology

Sum of the morphological changes indicative of kidney cell death and caused by the progressive degradation action of enzymes; may affect all or part of the kidney.

Method for detecting infectious spleen and kidney necrosis viruses by using hyper-branched rolling circle amplification

The invention discloses a method for detecting infectious spleen and kidney necrosis viruses by using hyper-branched rolling circle amplification, which is characterized by comprising the following steps of: (1) designing one locking type probe and a pair of universal primers for the connection sequence of the locking type probe; (2) making a connecting reaction system of the locking type probe for connecting reaction; and (3) making an HRCA (Hyper-branched Rolling Cycle Amplification) reaction system for HRCA reaction, and finally detecting the products of the HRCA reaction. Compared with the method for detecting the infectious spleen and kidney necrosis viruses by using PCR (Polymerase Chain Reaction) in the prior art, the method has the advantages of higher sensitivity, specificity and convenience, can be applied to actual production sites and is beneficial to detecting and controlling the cross infection of the infectious spleen and kidney necrosis viruses in the cultivation of aquatic animals.
Owner:NINGBO UNIV

Fluorescent quantitative PCR detection kit for infectious spleen and kidney necrosis virus and Fluorescent quantitative PCR detection method of infectious spleen and kidney necrosis virus

The invention discloses a fluorescent quantitative PCR detection kit for infectious spleen and kidney necrosis viruses and a fluorescent quantitative PCR detection method of the infectious spleen and kidney necrosis viruses. The detection kit and the detection method are characterized in that a specific primer and a probe are designed according to the sequence of a gene conservative area of the infectious spleen and kidney necrosis virus ORF007. The detection kit and the detection method have the advantages that the fluorescent quantitative PCR technology is adopted, the detection is simple, convenient and quick, the sensitivity is high, the specificity is strong, the repeatability is good, and the detection kit and the detection method can be applicable to monitoring of the infectious spleen and kidney necrosis viruses, and can also be used for detecting the virus content and the virus titer in siniperca chuatsi.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Mandarin fish infectious splenorenal necrosis virogene diagnostic kit and detecting method thereof

The present invention is mandarin fish infectious spleen and kidney necrosis virus gene diagnosing kit and its usage. The kit and its usage is designed based on two pairs of primers for the conservation sequence of mandarin fish infectious spleen and kidney necrosis virus gene. By means of PCR technology, the present invention detects qualitatively the specific DNA nucleic acid segment of mandarin fish infectious spleen and kidney necrosis virus fast, simply, specifically and sensitively. The present invention may be used in the tracing detection of different stages of mandarin fish cultivation and environment monitoring.
Owner:SUN YAT SEN UNIV

Fishes infectious spleen and kidney necrosis virus gene engineering vaccine and preparation method thereof

The invention provides a genetic engineering vaccine of fish infectious spleen and kidney necrosis virus and a process for preparing the genetic engineering vaccine. The genetic engineering vaccine provided by the invention comprises two gene recombination proteantigens of protein-24 and protein-50, and the protein-24 and the protein-50 are cloned by two open reading frames of ORF24 and ORF50 which are screened from a genome of ISKNV, then are prepared recombinant plasmid, and are finished by expressing recombinant protein. The vaccine is a recombinant protein vaccine which is capable of inhibiting the infectious spleen and kidney necrosis virus from infecting the fish body, enabling the aquatic fish to grow healthily, thereby reducing the loss due to disease in the marine industry, increasing the output and benefit of the marine product, simultaneously avoiding drawbacks existing in DNA vaccine.
Owner:SUN YAT SEN UNIV

Siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) inactivation rapid detection kit and detection method

The invention discloses a siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) inactivation rapid detection kit and a detection method. The detection kit and the detection method can monitor weather ISKNV is inactivated through detection of mRNA virus, specific steps are as follows: 7 days after an inactivated vaccine semi-finished product or finished product is inoculated with CPB cells, total cellular RNA is extracted, DNA residues are removed, reverse transcription is performed, a specific primer and a specific probe designed according to a siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) ORF099 gene conservation region sequence are used for fluorescence quantitative PCR reaction, and weather the ISKNV is completely inactivated can be determined according to a reaction result. The detection kit and the detection method can be used for rapid detection of siniperca chuatsi infectious spleen and kidney necrosis virus, can simplify inactivation inspection operation procedures of the ISKNV cell inactivated vaccine, shortens the test cycle, saves the cost, improves the sensitivity of the inactivation inspection, and improves vaccine production efficiency.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Application of siniperca chuatsi ISKNV (Infectious Spleen and Kidney Necrosis Virus) ORF093 protein

ActiveCN102240399AGood immune preventionGood neutralization effectViral antigen ingredientsAntiviralsRenal necrosisDisease
The invention discloses application of a siniperca chuatsi ISKNV (Infectious Spleen and Kidney Necrosis Virus) ORF093 protein in preparing a vaccine or a medicament for preventing a siniperca chuatsi ISKNV disease. The siniperca chuatsi ISKNV ORF093 protein plays a better immunoprophylaxis role on a siniperca chuatsi iridescent virus disease, has protection ratio exceeding 45 percent and can be developed into a new vaccine or a new medicament for resisting the siniperca chuatsi ISKNV disease.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Genetic markers for discrimination and detection of viruses causing infectious aquatic organism diseases, and method of discriminating and detecting the viruses using the same

The present invention relates to genetic markers for discrimination and detection of viruses causing infectious aquatic organism diseases, and a method of discriminating and detecting the viruses using the same, and more particularly to a method for discriminating or detecting viruses causing infectious aquatic organism diseases, the method comprising: selecting and amplifying a DNA nucleotide sequence encoding a gene specific for viral hemorrhagic septicemia virus (VHSV), red sea bream iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), which is a virus causing red sea bream iridovirus disease, or Koi herpesvirus (KHV); hybridizing a peptide nucleic acid (PNA) that specifically recognizes the amplification product; controlling the temperature of the hybridization product to obtain a temperature-dependent melting curve; and discriminating the viral type or detecting whether or not fish would be infected with the viral type by analyzing the obtained melting curve to determine a melting temperature.
Owner:REPUBLIC OF KOREA (NAT FISHERIES RES & DEV INST)

Triple fluorescent PCR detection kit for infectious spleen and kidney necrosis virus, largemouth bass ranavirus and siniperca chuatsi rhabdovirus

The invention belongs to the technical field of virus detection, and specifically relates to a triple fluorescent PCR detection kit for the infectious spleen and kidney necrosis virus, largemouth bassranavirus and siniperca chuatsi rhabdovirus. The kit of the invention comprises virus-specific amplification primers and probes, a positive standard, a negative standard, Taq enzyme, reverse transcriptase, a RNA enzyme inhibitor, a reaction buffer, dNTP, nuclease-free water and a freeze-drying protective agent. The kit of the invention can perform multiple channel detection at the same time by using triple fluorescent PCR, uses the different fluorescently labeled probes, can detect the three viruses simultaneously in one reaction system, reduces the detection difficulty, shortens the detection time, and can help raisers accurately get detection results in time. The kit of the invention has high detection sensitivity, high stability and strong specificity, has no cross-reactions with otheraquatic viruses, and can be used for early monitoring and prevention and control of epidemic diseases.
Owner:GUANGDONG HAID ANIMAL HUSBANDRY & VETERINARY RES INST

Detection method of infectious spleen and kidney necrosis virus Nest-PCR and kit thereof

The invention relates to a detection method of an infectious spleen and kidney necrosis virus Nest-PCR, which comprises the following steps of using total DNA of infected host spleen and kidney or sensitive clone as a template and using a standard substance as a positive control, carrying out a first round of PCR (Polymerase Chain Reaction) by using external inducers P1 TTACAGGATAGGGAAGCC and P2 ATGTCTGAATCTCAGGTGC, carrying out a round of PCR amplification by using products of the first round of PCR as the template and using internal inducers P3 ATGCTGGGCGCAAAGTAGTAG and P4 CGCGTCTACCTTAATTTGCCC, and detecting PCR products by agarose gel electrophoresis. The invention has the advantages of high detection specificity, high sensitivity, short detection time and simple operation.
Owner:CHINESE ACAD OF INSPECTION & QUARANTINE

Proliferation method of siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV)

The invention discloses a proliferation method of a siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV). According to the proliferation method, synchronous virus inoculation is adopted, the virus and a siniperca chuatsi brain tissue cell line (CPB) are in a suspended state, and the mutual contact surface area between the virus and the siniperca chuatsi brain tissue cell line is large so that the virus enters cells through more space receptors; and the virus infects the cells while the cells differentiate and proliferate, thus obtaining the high content ISKNV. After the CPB is cultured for 30 hours to 60 hours, the CPB is transferred to 5%-8% v / v of fetal calf serum culture medium, and the ISKNV is synchronously inoculated at the MOI (Multiplicity of Infection) value of 0.85-2.3, thus obtaining a low-cost ISKNV proliferation method. After the CPB is cultured for 20 hours to 40 hours, the CPB is transferred to 8%-10% v / v of fetal calf serum culture medium, and the ISKNV is synchronously inoculated at the MOI (Multiplicity of Infection) value of 30-45, thus obtaining a short ISKNV proliferation method. Cultivation methods can be selected according to existing conditions. The proliferation method provides theoretical basis for production of low-cost viruses.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Application of BAPTA derivative in the preparing process of clinical medicine

The present invention features that BAPTA derivative is applied in preparing medicine for treating acute great area cell death clinically. The medicine is prepared into particle preparation for the clinical salvage and treatment of acute great area cell death diseases, such as cerebral infarction, myocardial infarction, liver necrosis, ischemic kidney necrosis, necrotic pencreatitis, etc.
Owner:HENGXING PHARMA INST HEFEI

Digital PCR detection primer and reagent kit for detecting infectious spleen and kidney necrosis viruses

The invention provides a digital PCR detection primer and specificity probe for detecting infectious spleen and kidney necrosis viruses. The primer is characterized in that the upstream nucleotide sequence of the primer is shown as SEQID NO:1, and the downstream nucleotide sequence of the primer is shown as SEQID NO:2. The nucleotide sequence of the specificity probe is shown as SEQID NO:3. The invention further provides a reagent kit including the digital PCR detection primer and the specificity probe and used for detecting infectious spleen and kidney necrosis viruses. The reagent kit and droplet digital PCR are combined for use to detect ISKNV viruses, the detection sensitivity is high, and a standard curve is not set. According to detection results, the nucleic acid copy number of ISKNV in samples can be directly red, and the operation steps can be greatly simplified.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Primer set for detecting infectious spleen and kidney necrosis virus and siniperca chuatsi rhabdovirus and kit

The invention provides a primer set for detecting infectious spleen and kidney necrosis virus and siniperca chuatsi rhabdovirus. The primer set includes two pairs of primers, and the sequences of thefirst pair of primers are shown as SEQ ID NO: 3 and SEQ ID NO: 4, the sequences of the second pair of primers are shown as SEQ ID NO: 7, SEQ ID NO: 8. According to the primer set, the infectious spleen and kidney necrosis virus and siniperca chuatsi rhabdovirus can be quickly detected simultaneously, operation procedures can be simplified, and the cost is reduced.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Determination method of effective antigen contents of infectious spleen and kidney necrosis virus inactivated vaccine and kit

The invention discloses a determination method of effective antigen contents of an infectious spleen and kidney necrosis virus inactivated vaccine. According to the method, an active antigen in a to-be-tested sample is captured by taking a monoclonal antibody which is capable of recognizing ISKNV virus major capsid protein (MCP) as a capture antibody; and the captured effective antibody is quantified by taking another monoclonal antibody which is capable of recognizing different antigen epitopes of the infectious spleen and kidney necrosis virus MCP as a detection antibody. The method and a kit adopting the method provided by the invention have the advantages of being high in sensitivity, broad in linear range, convenient to use, short in required time and the like; the method is applicable to determination of effective antigen contents in a semi-finished product and a finished product in an infectious spleen and kidney necrosis virus inactivated vaccine production process; therefore,a novel method is provided for the quality control of the infectious spleen and kidney necrosis virus inactivated vaccine; and the quality of the vaccine can be guaranteed, and the production efficiency of the vaccine can be improved.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Infectious spleen and kidney necrosis virus vaccine and preparation method and application thereof

The invention discloses an infectious spleen and kidney necrosis virus vaccine and a preparation method and application thereof. The vaccine is obtained by inoculating the infectious spleen and kidney necrosis virus in fish cells, harvesting and inactivating virus fluid. The preparation method of the vaccine comprises four steps such as preparation of cells, inoculation and cultivation of viruses, collection, inactivation and dilution of viruses and preparation of vaccines. The infectious spleen and kidney necrosis virus vaccine of the invention can be used for preventing infectious spleen and kidney necrosis virus infection of fresh-water and sea fishes, has protective action up to 100%, contains no components which are harmful to humans and can be safely eaten by vaccinated fishes; in addition, the vaccine has no influence on the growth of fishes and has immunity lasting over half a year. The preparation method of the vaccine is simple and the used reagents are low in cost, therefore, the vaccine is favorable for large-scale promotion.
Owner:SUN YAT SEN UNIV

LAMP detection method of mandarin fish infectious spleen and kidney necrosis viruses

The invention discloses a LAMP detection method of mandarin fish infectious spleen and kidney necrosis viruses. The LAMP detection method comprises the following steps of designing four specific primers according to six areas of an infectious spleen and kidney necrosis virus specific segment, carrying out fast amplification on the template DNA specific area by LAMP, and adding a dye and observing a color change under natural light by naked eyes thereby determining a result. The LAMP detection method has the whole reaction time less than or equal to 2h and LAMP forms waterfall-type amplification so that amplification efficiency is very high, sensitivity is improved by 100 times than that of common PCR, a complex detection apparatus and a detection process are avoided, processes are simple and on-site real-time detection is realized. Therefore, the LAMP detection method of mandarin fish infectious spleen and kidney necrosis viruses has the advantages of fast detection, high sensitivity, simple and convenient operation, low cost and easy determination of a detection result.
Owner:HUAZHONG AGRI UNIV

Establishing method of myosatellite cell system of bastard halibut during embryo period

ActiveCN108753703AOvercome dysfunctional issuesCultivate suitableCell dissociation methodsCulture processFunctional genesSeawater
The invention relates to a marine fish embryo cell culture technology, in particular to an establishing method of a myosatellite cell system of bastard halibut during an embryonic period. The establishing method comprises the following steps: carrying out in-vitro separation on an embryo during a bastard halibut kirschner capsule formation period, removing an egg membrane, dispersing cells, and carrying out primary culture and secondary culture, thus establishing the myosatellite cell system during the embryonic period. The form of the myosatellite cell system, established by the invention, ofthe bastard halibut is fusiform or spindle-shaped mononuclear cells; myofiber can be differentiated to form by culturing for 5 days or above within a single generation or carrying out induction of anexogenous factor (horse serum). The myosatellite cell system is capable of supplying a large amount of myosatellite cells, and GFD (Green Fluorescent Protein) transfection and cynoglossus semilaevisspleen and kidney necrosis virus challenge assay detection verify that the myosatellite cells can be normally transfected or infected, so that the myosatellite cell system not only can be directly used for researching functional genes related to muscle growth and development of fishes and providing research materials for exploring a molecular mechanism for induction, proliferation and differentiation of muscle cells of the fishes, but also is capable of providing a platform for improved research and application of muscle characters in bastard halibut breeding.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Antibacterial peptide CSTC24 and application thereof

The invention relates to an antibacterial peptide CSTC24 and application thereof, in particular to an antibacterial peptide.The antibacterial peptide is characterized in that the sequence of the antibacterial peptide is shown in SEQ ID No.1.The antibacterial peptide can effectively kill three fish pathogenic bacteria of vibrio vulnificus, micrococcus luteus and staphylococcus aureus, and infectious spleen and kidney necrosis viruses.The antibacterial peptide is excellent in effect through experimental verification.
Owner:QINGDAO AGRI UNIV

Fluorescent quantitative PCR method for detecting infectious spleen and kidney necrosis virus of mandarin fish and corresponding kit

PendingCN111485035AHigh amplification efficiencyAchieving correct detectionMicrobiological testing/measurementRenal necrosisNecrovirus
The invention discloses a fluorescent quantitative PCR method for detecting infectious spleen and kidney necrosis virus of mandarin fish and a corresponding kit. Specific gene detection is ingeniouslyapplied to distinguish the infectious spleen and kidney necrosis virus of the mandarin fish from strains or viruses of other species, and accurate bacterial genus information is obtained through comprehensive determination. Compared with an existing mainstream detection kit, the kit for detecting the infectious spleen and kidney necrosis virus of the mandarin fish has the advantages of being highin sensitivity, rapid, convenient to use, good in specificity, rigorous and accurate in judgment and the like, and has good application prospects and market value.
Owner:广东美格基因科技有限公司

Antibody for detecting infectious spleen and kidney necrosis viruses as well as preparation and application thereof

The invention discloses an antibody for detecting infectious spleen and kidney necrosis viruses as well as preparation and application thereof. The antibody for detecting infectious spleen and kidney necrosis viruses is a purified anti-rabbit ISKNV-23P8 polyclonal antibody which is capable of specifically recognizing ISKNV-23P8, obtained by adopting an amino acid residue containing a sequence having a sequence number of SEQ ID NO: 1 as an epitope. The antibody is used for detecting the infectious spleen and kidney necrosis viruses and has specificity. An immunofluorescence detection kit for the infectious spleen and kidney necrosis viruses and a non-diagnostic immunofluorescence rapid detection method for infectious spleen and kidney necrosis virus-infected imprints have the characteristics of good specificity, simple operation, quickness and sensitivity, have obvious advantages compared with a PCR method, and can be used for ISKNV infection detection during the culture of various susceptible fishes; and all operations can be completed within 1.5 hours.
Owner:GUANGDONG HAID ANIMAL HUSBANDRY & VETERINARY RES INST

Mandarin fish infectious splenorenal necrosis virogene diagnostic kit and detecting method thereof

The present invention is mandarin fish infectious spleen and kidney necrosis virus gene diagnosing kit and its usage. The kit and its usage is designed based on two pairs of primers for the conservation sequence of mandarin fish infectious spleen and kidney necrosis virus gene. By means of PCR technology, the present invention detects qualitatively the specific DNA nucleic acid segment of mandarin fish infectious spleen and kidney necrosis virus fast, simply, specifically and sensitively. The present invention may be used in the tracing detection of different stages of mandarin fish cultivation and environment monitoring.
Owner:SUN YAT SEN UNIV

Construction method and application of vector vaccine for resisting infectious spleen and kidney necrosis viruses

The invention discloses a construction method and application of a vector vaccine for resisting infectious spleen and kidney necrosis viruses, and belongs to the technical field of virus genetic engineering. The vector vaccine comprises an antigen protein MCP expressed by a bombyx mori nuclear polyhedrosis virus and shown as SEQ ID NO: 10, and the antigen protein is encoded by a cmv-mcp expression cassette shown as SEQ ID NO: 1. According to the construction method, the mcp expression cassette cmv-mcp controlled by a cytomegalovirus promoter cmv is cloned to a transfer plasmid to construct a recombinant plasmid, then competent cells are transformed to obtain Bacmid-MCP, the Bacmid-MCP DNA transfects bombyx mori culture cells to obtain BmNPV-MCP, then the BmNPV-MCP is inoculated to larvae or primary pupae of bombyx mori at the age of 4-5, and homogenate is carried out after the disease is attacked to obtain the vector vaccine. The vaccine is used for immunizing siniperca chuatsi / weever through an injection, oral administration or soaking method, and the occurrence of infectious spleen and kidney necrosis diseases can be reduced.
Owner:苏州培恩特生物科技有限公司

Infectious spleen and kidney necrosis virus (ISKNV) gene intron and its use in distinguishing of live and inactivated ISKNVs

The invention discloses an infectious spleen and kidney necrosis virus (ISKNV) gene intron and its use in distinguishing of live and inactivated ISKNVs and belongs to the field of virus detection. The intron is located on ORF003L of an ISKNV genome NC_003494.1, has length of 80bp and is named as IN-3. The invention discloses the intron of ISKNV. The intron is named as IN-3. Through the characteristics of transcription shearing of the intron IN-3, the intron IN-3 is used as a virus complete inactivation index, and an ISKNV inactivation rapid detection nested RT-PCR method is established. The ISKNV gene intron can shorten an inactivation test cycle in ISKNV cell inactivated vaccine production process and improve vaccine production efficiency.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Method for producing siniperca chuatsi infectious spleen and kidney necrosis virus and siniperca chuatsi rhabdovirus through microcarrier suspension culturing CPB cells

The invention discloses a method for producing a siniperca chuatsi infectious spleen and kidney necrosis virus and a siniperca chuatsi rhabdovirus through microcarrier suspension culturing CPB cells. The method comprises the steps of selecting the CPB cells as a cell line for making vaccines; sequentially carrying out step-by-step magnifying microcarrier suspension culture on the CPB cells through stirring bottles and bioreactors, so that the CPB cells are used as hosts of virus infection; finally obtaining the siniperca chuatsi infectious spleen and kidney necrosis virus bulk and the siniperca chuatsi rhabdovirus bulk. The prepared ISKNV potency reaches up to 8.34LgTCID50 / mL, and the SCRV potency reaches up to 10.25LgTCID50 / mL. A microcarrier suspension culture process adopted by the invention is simple to operate, less in pollution probability, small in labor force compared with a roller bottle culture method, and lower in production cost.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Proliferation method of siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) based on epithelioma papulosum cyprinid (EPC)

The invention belongs to the field of biotechnology and in particular relates to a proliferation method of siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) based on epithelioma papulosum cyprinid (EPC). The proliferation method comprises the following steps: culturing an EPC cell line; inflecting EPC cells by using ISKNV, culturing at constant temperature, then collecting culture solution supernatant; inflecting the EPC cells again by using ISKNV in the culture solution supernatant, repeatedly operating for 2-3 times, rejuvenating ISKNV seeds, taking culture solution supernatant nitrogen and saving the ISKNV seeds as ISKNV amplification seeds; inflecting the EPC cells by using the rejuvenated ISKNV seeds, culturing at constant temperature till CPE is greater than 80%, and collecting supernatant to obtain ISKNV particles. The EPC cell line is used as sensitive cells infected by ISKNV; the EPC cell line is high in degree of commodity, easy to get, easy to culture and distant in genetic relationship with siniperca chuatsi; the purification difficulty of ISKNV for inactivating vaccines can be greatly reduced; the adverse effects are reduced.
Owner:WUHAN ACADEMY OF AGRI SCI

PCR primer group for rapidly detecting three fish viruses and application thereof

The invention discloses a triple PCR primer group for rapidly detecting three fish viruses and application thereof, and relates to the technical field of gene detection. The invention discloses a triple PCR primer group for rapidly detecting three fish viruses. The triple PCR primer group comprises an infectious spleen and kidney necrosis virus ISKNV primer, a mandarin fish frog virus SCRIV primerand a mandarin fish rhabdovirus SCRV primer, the triple PCR primer group has high sensitivity, the detection time is 2-3 hours earlier than that of conventional PCR, the efficiency of clinical diagnosis is greatly improved, richer reference bases can be provided for epidemiological investigation of ISKNV, SCRIV and SCRV infection, and the triple PCR primer group has important significance for subsequent research and prevention and treatment.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

A kind of infectious spleen and kidney necrosis virus orf069 gene deletion strain and its preparation method and application

The invention provides an infectious spleen-kidney necrosis virus ORF069 gene deletion strain and its preparation method and application, which is an attenuated virus strain prepared by deleting the ORF069 gene of the infectious spleen-kidney necrosis virus strain. The present invention also provides an infectious spleen and kidney necrosis virus ORF069 gene deletion strain with a selection marker and its preparation method and application, wherein the ORF069 gene is deleted for the infectious spleen and kidney necrosis virus, and homologous recombination is carried out at the gene deletion site An attenuated virus strain made by inserting a selection marker gene. The infectious spleen-kidney necrosis virus ORF069 gene deletion strain provided by the present invention is a recombinant genetically engineered vaccine in which the ORF069 gene has been knocked out. Immunity effect, without injection, great application value.
Owner:SUN YAT SEN UNIV

Antibody for detecting infectious spleen and kidney necrosis virus and its preparation and application

The invention discloses an antibody for detecting infectious spleen-kidney necrosis virus and its preparation and application; the antibody for detecting infectious spleen-kidney necrosis virus is a purified rabbit anti-ISKNV-23P8 polyclonal antibody, which contains the sequence number as SEQ An amino acid residue of ID NO: 1 is an epitope antigen, and a polyclonal antibody that specifically recognizes ISKNV‑23P8 is obtained. The antibody is used to detect infectious spleen-kidney necrosis virus and is specific. The infectious spleen and kidney necrosis virus immunofluorescence detection kit and the non-diagnostic immunofluorescence rapid detection method of infectious spleen and kidney necrosis virus infection prints of the present invention have the characteristics of good specificity, simple operation, rapidity and sensitivity, and are relatively The PCR method has obvious advantages, and all operations can be completed within 1.5 hours, and can be used for the detection of ISKNV infection in the breeding process of various susceptible fish.
Owner:GUANGDONG HAID ANIMAL HUSBANDRY & VETERINARY RES INST

Integral solution technical scheme for precise prevention and control of infectious spleen and kidney necrosis virus disease of mandarin fish

The invention discloses an integral solution technical scheme for precise prevention and control of infectious spleen and kidney necrosis virus disease of mandarin fish. The scheme is as follows: a magnetic bead method virus DNA / RNA nucleic acid extraction kit (LBT-VDEK) is used, a 16-well fluorescent quantitative PCR instrument (LBT-16QPCR) and support equipment thereof are utilized, a PCR-fluorescent probe technology is used, and specific DNA nucleic acid fragments of infectious spleen and kidney necrosis virus of mandarin fish are quantitatively detected. The schem is simple, convenient and rapid, and has good specificity and high sensitivity. A modern traditional Chinese medicine technology and a micro-ecological technology are used. The infectious spleen and kidney necrosis virus of the mandarin fish is prevented and treated. The scheme can effectively reduce mortality, achieves accurate prevention and control, comprehensively, systematically and integrally solves the infectious spleen and kidney necrosis virus disease of the mandarin fish, and has a very wide use prospect and a very high practical value.
Owner:广州力必拓生物科技有限公司

Method and kit for measuring effective antigen content of inactivated vaccine against infectious spleen and kidney necrosis virus

The invention discloses a method for determining the effective antigen content of an infectious spleen and kidney necrosis virus inactivated vaccine. The method uses a monoclonal antibody that can recognize the main capsid protein (MCP) of the ISKNV virus as a capture antibody to capture in the sample to be tested. The effective antigen of the captured effective antigen was quantified by using another monoclonal antibody that recognizes different epitopes of infectious spleen and kidney necrosis virus MCP as a detection antibody. The method of the present invention and the kit using the method have the advantages of high sensitivity, wide linear range, convenient use, and short time required, and can be used for effective antigens in semi-finished products and finished products in the production process of infectious spleen and kidney necrosis virus inactivated vaccines. The determination of the content provides a new method for the quality control of the inactivated vaccine of infectious spleen and kidney necrosis virus, which can ensure the quality of the vaccine and improve the production efficiency of the vaccine.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI