Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

80 results about "Gene conservation" patented technology

Conservation genetics is an interdisciplinary subfield of Population Genetics that aims to understand the dynamics of genes in populations principally to avoid extinction.

Method for simultaneously detecting twelve kinds of common respiratory viruses

The invention discloses a method for simultaneously detecting twelve kinds of common respiratory viruses. According to the method, primers and probes are designed according to gene conservative areas of the twelve kinds of common respiratory viruses, namely influenza A virus, influenza B virus, influenza C virus, parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, rhinovirus, Bocavirus, adenovirus, coronavirus, metapneumovirus and respiratory syncytial virus, nucleic acid fragments of samples to be measured are extracted for amplifying, and finally, the samples are separated by using a capillary electrophoresis method. The method disclosed by the invention has the advantages of low required sample size, high sensitivity and accuracy, good specificity and low cost; the defects that the conventional single tube multiplex fluorescence PCR (Polymerase Chain Reaction) detection primers are difficult to design, and multicolor fluorescence mutually intervenes and is not easy to part are overcome, the defects that a chip detection method is tedious in operation, high in detection cost and the like are also overcome, and a new method is provided for screening the respiratory viruses.
Owner:FUJIAN INT TRAVEL HEALTH CARE CENT +1

Fluorescent quantitative PCR detection kit for infectious spleen and kidney necrosis virus and Fluorescent quantitative PCR detection method of infectious spleen and kidney necrosis virus

The invention discloses a fluorescent quantitative PCR detection kit for infectious spleen and kidney necrosis viruses and a fluorescent quantitative PCR detection method of the infectious spleen and kidney necrosis viruses. The detection kit and the detection method are characterized in that a specific primer and a probe are designed according to the sequence of a gene conservative area of the infectious spleen and kidney necrosis virus ORF007. The detection kit and the detection method have the advantages that the fluorescent quantitative PCR technology is adopted, the detection is simple, convenient and quick, the sensitivity is high, the specificity is strong, the repeatability is good, and the detection kit and the detection method can be applicable to monitoring of the infectious spleen and kidney necrosis viruses, and can also be used for detecting the virus content and the virus titer in siniperca chuatsi.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Specific primer sequence capable of being applied in method for identifying different fish, and DNA (Deoxyribose Nucleic Acid) molecular marker method for identifying different fish

The invention discloses a specific primer sequence capable of being applied in a DNA (Deoxyribose Nucleic Acid) molecular marker method for identifying different fish. The specific primer sequence comprises an upstream primer and a downstream primer. The DNA molecular marker method for identifying different fish by using the specific primer sequence comprises the steps that a specific primer is designed according to a 5S rDNA genic conservative coding region sequence of the given fish; a genome of a fish material to be identified is extracted; a PCR (Polymerase Chain Reaction) system is designed by taking DNA of the genome as a template; a 5S rDNA gene of the system is amplified; a DNA segment mode of the sample 5S rDNA gene is obtained after PCR amplified reaction, agarose gel electrophoresis and DNA gel recovery kit purification by utilizing the polymorphyism of a nontranscribed spacer of the 5S rDNA gene; and finally the kind of the fish material to be identified is judged by comparing the DNA segment mode in gel imaging with the given fish. The method has the advantages that the method is rapid, accurate, and easy and simple to operate.
Owner:HUNAN NORMAL UNIVERSITY

Gene conserved sequence, primer probe combination, kit and application for detecting neocoronavirus

The invention provides a gene conserved sequence, a primer probe, a kit and application for detecting neocoronavirus, and belongs to a molecular biological nucleic acid detection technology. In orderto solve the technical problems of better specific detection of the neocoronavirus, sensitivity during detection and the like, the invention provides the gene conserved sequence, the primer probe, thekit and the application for detecting an ORF1ab / N gene of the neocoronavirus, and belongs to the molecular biological nucleic acid detection technology. The invention aims to improve the specificity,the sensitivity and the detection efficiency of neocoronavirus detection, so that the whole detection process is simpler, more convenient, quicker and more efficient.
Owner:SHANGHAI BIOGERM MEDICAL TECH CO LTD

LAMP primer group for detecting phytoplasma as well as kit of LAMP primer group and application of kit

The invention discloses an LAMP primer group for detecting phytoplasma as well as a kit of the LAMP primer group and an application of the kit. The LAMP primer group, which is strong in specificity and is constituted by nucleotide sequences shown as SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5, is finally obtained by designing six groups of primers for six regions of the conserved sequence of a 16S gene of 16SrI group phytoplasma and designing two groups of primers for six regions of the conserved sequence of a tuf gene of the 16SrI group phytoplasma. The invention further discloses the kit of paulownia witch phytoplasma, Chinaberry witch phytoplasma, mulberry dwarf phytoplasma, lettuce yellow phytoplasma and catharanthus roseus green phytoplasma prepared by virtue of the primer group and the invention also establishes a detection method; the detection method has the advantages of being good in stability, strong in specificity, high in sensitivity and the like; and the method is applicable to the detection of the paulownia witch phytoplasma, the Chinaberry witch phytoplasma, the mulberry dwarf phytoplasma, the lettuce yellow phytoplasma and the catharanthus roseus green phytoplasma.
Owner:INST OF FOREST ECOLOGY ENVIRONMENT & PROTECTION CHINESE ACAD OF FORESTRY

Mitochondrion complete genome sequence of hucho taimen and amplification primers thereof

The invention discloses a mitochondrion complete genome sequence of hucho taimen and amplification primers of the mitochondrion complete genome sequence, which relate to the mitochondrion complete genome sequence and the amplification primer of the mitochondrion complete genome sequence. The mitochondrion complete genome sequence of the hucho taimen determined by the invention provides a material basis for conservation genetics, evolutionary genetics and molecular marker assisted selection of good breeding species of the hucho taimen. The mitochondrion complete genome sequence of the hucho taimen is as shown by SEQ ID NO:1. The mitochondrion complete genome sequence of the hucho taimen comprises 33 pairs of the amplification primers. The mitochondrion complete genome sequence of the hucho taimen and the amplification primers of the mitochondrion complete genome sequence provide the material basis for the conservation genetics, the evolutionary genetics and the molecular marker assisted selection of the good breeding species of the hucho taimen.
Owner:HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI

Primer, probe and kit for detecting mutation of human JAK2 gene V617F

The invention discloses a primer, a probe and a kit for detecting a mutation of a human JAK2 gene V617F. The primer comprises a mutation forward primer JW1-F and a mutation reverse ARMS primer JM1-R, and the probe comprises a detection probe JW1-P and a blocking probe JW1-B, wherein the mutation forward primer JW1-F is combined with a JAK2 gene conserved sequence; the mutation reverse ARMS primer JM1-R is specifically combined with a V617F (1849G>T) site mutation sequence to selectively amplify the mutation sequence; a 5minute end of the detection probe JW1-P is marked with an FAM (carboxy fluorescein) signal; a 3minute end of the detection probe is marked with an MGB (Minor Groove Binder); the detection probe JW1-P can be combined with an amplified fragment; a 5minute end of the blocking probe JW1-B is double-deoxidized and modified; a 3minute end of the blocking probe JW1-B is marked with the MGB; the blocking probe JW1-B can be specifically combined with a V617 site wild-type sequence to inhibit wild-type nonspecific amplification. The primer and the probe which are disclosed by the invention are high in specificity and good in sensitivity, and have high detectability of 1 percent. The kit prepared from the primer and the probe is accurate in detection result and easy in reading of the detection result, is simple and rapid to operate, and is wide in application range.
Owner:武汉海吉力生物科技有限公司

Siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) inactivation rapid detection kit and detection method

The invention discloses a siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) inactivation rapid detection kit and a detection method. The detection kit and the detection method can monitor weather ISKNV is inactivated through detection of mRNA virus, specific steps are as follows: 7 days after an inactivated vaccine semi-finished product or finished product is inoculated with CPB cells, total cellular RNA is extracted, DNA residues are removed, reverse transcription is performed, a specific primer and a specific probe designed according to a siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) ORF099 gene conservation region sequence are used for fluorescence quantitative PCR reaction, and weather the ISKNV is completely inactivated can be determined according to a reaction result. The detection kit and the detection method can be used for rapid detection of siniperca chuatsi infectious spleen and kidney necrosis virus, can simplify inactivation inspection operation procedures of the ISKNV cell inactivated vaccine, shortens the test cycle, saves the cost, improves the sensitivity of the inactivation inspection, and improves vaccine production efficiency.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Taqman probe fluorescent quantitative PCR detection kit for identifying canine distemper virus wild strain and vaccine strain as well as application thereof

PendingCN108842003ARapid infectionDifferential Diagnosis TaqMan Probe Fluorescent Quantitative PCR Method SpecificMicrobiological testing/measurementMicroorganism based processesCanine distemper virus CDVPcr method
The invention discloses a Taqman probe fluorescent quantitative PCR detection kit for identifying a canine distemper virus wild strain and a vaccine strain as well as application thereof. The kit comprises a universal primer for amplifying a canine distemper virus wild strain and vaccine strain H gene conservation area as well as a specific probe for identifying a canine distemper virus wild strain or a vaccine strain. The experiment proves that the Taqman probe fluorescent quantitative PCR detection kit is used for detecting and identifying the CDV wild strain and the vaccine strain, the sensitivity can reach to 1 copy; 103 to 102 copies with the virus quantity as low as 1 TCID50 / mL and higher than that of the conventional method can be detected; and through detection on five kinds of other pathogen nucleic acid, the copies are negative. Therefore, the kit for identifying the CDV wild strain and the vaccine strain has the characteristics of high specificity, high sensitivity and highstability, and can rapidly identify canine distemper virus wild strain and vaccine strain infection.
Owner:INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS

Amplification primer for amplifying complete sequence of mitochondrial genome of cyprinid fish and amplification method

The invention discloses an amplification primer for amplifying a complete sequence of a mitochondrial genome of cyprinid fish. The amplification primer comprises three groups of outer primers and inner primers respectively used for amplifying three long-fragment sequences of the mitochondrial genome and a pair of sequencing primers. The complete sequence of the mitochondrial genome of the cyprinidfish is obtained by using the amplification primer, and a material foundation is provided for conservation genetics and evolutionary genetics of the cyprinid fish as well as the molecular identification of species. The invention further discloses an amplification method for amplifying the complete sequence of the mitochondrial genome of the cyprinid fish. The method is simple, convenient, efficient, fast, and low in time, labor and money consumption.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Methods for acquiring micro-satellite sequence and polymorphic micro-satellite markers of hucho taimen and polymorphic micro-satellite markers of hucho taimen

The invention discloses methods for acquiring a micro-satellite sequence and polymorphic micro-satellite markers of hucho taimen and the polymorphic micro-satellite markers of the hucho taimen, which relate to a method for acquiring the micro-satellite sequence and the polymorphic micro-satellite markers and the polymorphic micro-satellite markers. The method for acquiring the micro-satellite sequence comprises the following steps: firstly, extracting a hucho taimen genome DNA; secondly, performing enzyme cutting on the hucho taimen genome DNA and constructing a micro-satellite enrichment library; and thirdly, performing colony PCR amplification and performing positive clone detection and sequencing. The method for acquiring the polymorphic micro-satellite markers of the hucho taimen comprises the following steps: performing the first step to the third step the same as that of the method for acquiring the micro-satellite sequence; fourthly, analyzing the micro-satellite sequence of the hucho taimen and designing a primer; and fifth, performing polymorphic identification on the primer of the micro-satellite sequence. The method acquires seven pairs of the polymorphic micro-satellite markers of the hucho taimen. The biological materials obtained by the methods can be used for conservation genetics, genetic relationship analysis, linkage map construction and genetic management of cultured populations of the hucho taimen.
Owner:HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI

Siniperca chuatsi ranairidovirus and rhabdovirus duplex PCR detection kit and detection method

The invention relates to a siniperca chuatsi ranairidovirus and rhabdovirus duplex PCR detection kit and detection method, and belongs to the technical field of PCR. The siniperca chuatsi ranairidovirus and rhabdovirus duplex PCR detection kit provided by the invention comprises primers, EasyTaq PCR SuperMix, a negative control solution and a positive control solution, wherein the primers comprisea primer designed by aiming at an MCP gene conserved region of the siniperca chuatsi ranairidovirus, and a primer designed by aiming at an N gene conserved region of the siniperca chuatsi rhabdovirus. The siniperca chuatsi ranairidovirus and rhabdovirus duplex PCR detection kit and detection method provided by the invention can be used for fast, efficiently and accurately detecting the sinipercachuatsi ranairidovirus and the siniperca chuatsi rhabdovirus at the same time; the time and the labor are saved; more treatment time is won for sick siniperca chuatsi; and important significance is realized on subsequent study, prevention and control.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Kit and detection method for detecting vibrio harveyi

The invention relates to a kit and detection method for detecting vibrio harveyi by using the loop-mediated isothermal amplification technique. The kit comprises a loop-mediated isothermal amplification reaction solution, a Bst DNA (deoxyribonucleic acid) polymerase and a color-developing agent, wherein the reaction solution contains a reaction buffering solution Thernopol, dNTP (deoxyribonucleotide triphosphate), MgSO4, a forward inter primer (Vh-FIP) TTCGCTTTCGCGAGCCATCTGGTTACCAATTGATCGCCCG, a reverse inter primer (Vh-BIP) ACGCAGAATCAAGCAGTGTGCCGATTTATTCGCCACGACA, a forward outer primer (Vh-F3) CAAAACGGTTCCGAAACGC, a reverse outer primer (Vh-B3) TCGATTCCCCAAGTTTGGAG, a betaine, and sterile distilled water. The detection method comprises the following steps: extracting bacterium DNAs, carrying out loop-mediated isothermal amplification, carrying out color-developing detection and the like. By designing the primers according to the vibrio harveyi toxR gene conservation area and detecting by using the LAMP (loop-mediated isothermal amplification) technique, the invention achieves high specificity and high sensitivity; the kit has the advantages of high detection speed, high accuracy, excellent sensitivity, convenient on-site application and the like; and the defects of long cycle, low sensitivity, high cost, difficult on-site application and the like in the prior art are solved.
Owner:陈吉刚

Monoclonal antibody of avian reticuloendotheliosis virus envelope protein and preparation method thereof

The invention belongs to the cross technical field of molecular immunology and virology, and particularly relates to a monoclonal antibody of avian reticuloendotheliosis virus envelope protein. The monoclonal antibody is characterized in that 1200bp of genetic fragment in a relative conservation region of an avian reticuloendotheliosis virus (REV) envelope (env) gene is selected, and 400 amino acids expressed by the fragment comprise more than 90% of antigen sites of the REV, so that most of the antigen sites of the virus are retained and the interference caused by genovariation is excluded, prokaryotic expression product His-env fusion protein is obtained by utilizing the env gene containing the conservation genetic fragment, the Balb / C mouse is immunized by the fusion protein, and the monoclonal antibody of the REV ENV (envelope) protein is obtained through fusion of oncocyte SP2 / 0 and splenocyte of the immunized mouse, screening and cloning. The monoclonal antibody provides a technical support for diagnosis and prevention as well as scientific research of avian reticuloendotheliosis.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Novel gosling gout virus one-step method loop-mediated isothermal detection reagent and application thereof

The invention provides a novel gosling gout virus (N-GoAstV) one-step method loop-mediated isothermal detection reagent and application thereof and relates to the technical field of virus detection. According to the detection reagent, specific LAMP (loop-mediated isothermal amplification) primers are designed and synthesized according to an N-GoAstV gene conserved region; the primers comprise an upstream inner primer FIP, a downstream inner primer BIP, an upstream outer primer F3, a downstream outer primer B3, an upstream looped primer LF and a downstream looped primer LB; and the detection reagent comprises the following components: a 10x reaction buffer, dNTPs (deoxynucleotides), MgSO4, Bst 3.0DNA polymerase, deionized water, a developing reagent and the primers. The detection reagent provided by the invention has the advantages of being good in specificity, high in sensitivity, simple and convenient to operate, low in cost, and the like.
Owner:NANYANG NORMAL UNIV

Amplification primer and amplification method of complete mitochondrial genome sequence of nibea japonic

The invention discloses an amplification primer and an amplification method of complete mitochondrial genome sequence of nibea japonic; through PCR amplification on the genome of nibea japonic by virtue of 20 pairs of specific primers, the complete mitochondrial genome sequence of the nibea japonic can be obtained, so that material basis is provided for conservation genetics and evolutionary genetics of nibea japonic as well as for molecular marker-assisted selection of excellent breeding varieties.
Owner:MARINE FISHERIES RES INST OF ZHEJIANG

Preparation method of swine fever virus nucleic acid standard substance

The invention relates to a preparation method of a swine fever virus nucleic acid standard substance. The swine fever virus nucleic acid standard substance is prepared through the following technical steps: (1) selecting a gene conservation area as an amplification target area; (2) designing and synthesizing a primer; (3) carrying out sequence amplification; (4) carrying out cloning and identification; (5) carrying out in vitro transcription; (6) sub-packaging; (7) determining RNA copy number; (8) inspecting; (9) carrying out collaborative calibration; and (10) setting value. The swine fever virus nucleic acid standard substance prepared by utilizing the preparation method has no infection, a wide range of applications, good uniformity, high stability and accurate set value of the copy number, and can be used for quality control, contrast between scientific research and laboratory diagnosis and capacity contrast among laboratories of RT-PCR or fluorescent quantitative PCR diagnostic reagents.
Owner:CHINA INST OF VETERINARY DRUG CONTROL

Primer set for performing fluorescence quantitative PCR detection on decapod iridescent virus 1 ( Decapod iridescent virus 1, DIV1 ) and reagent kit

The invention discloses a primer set for performing fluorescence quantitative PCR detection on decapod iridescent virus 1 ( Decapod iridescent virus 1, DIV1 ) and a reagent kit, and belongs to the technical field of virus detection. The primer set specifically comprises a primer for detecting the decapod iridescent virus 1 and a TaqMan-MGB probe, and a reagent kit based on the detection primer andthe probe. Through the primer set disclosed by the invention, according to an MCP gene consensus sequence of DIV1, a specific primer and the TaqMan-MGB probe are designed, a recombinant plasmid standard product pMD18-T-MCPDIV1 is prepared, a TaqMan-MGB probe fluorescence quantitative PCR method for detecting DIV1 is established, the TaqMan-MGB probe fluorescence quantitative PCR method has the advantages of being high in sensitivity, high in specificity, good in repeatability, wide in quantitative range, simple and quick and the like; and a corresponding detection reagent kit is researched and developed, and popularization and application are convenient, so that quick quantitative detection of the DIV1 and the prevention and control of relevant diseases are facilitated.
Owner:GUANGXI ACADEMY OF FISHERY SCI

Kit for detecting pathogenic bacteria of mucor lungs as well as use method and application of kit

The invention discloses a kit for detecting pathogenic bacteria of mucor lungs as well as a use method and an application of the kit. The kit of the present invention comprises a universal primer capable of being present in the form of a mixture, wherein the universal primer is capable of binding to a common gene conserved region of rhizopus oryzae, rhizomucor micranthum, aureobasidium pullulans, rhizopus stolonifer, and Cunninghamia lanceolata. The kit provided by the invention can realize one-time detection of various mucor fungi, the detection time does not exceed 2 hours, and the specific type of mucor can be further determined in one-time detection.
Owner:上海捷诺生物科技有限公司

Method of improving plant type of dendrocalamus latiflorus with GRG1 gene and application of method

ActiveCN110724693AConvenient for functional researchPromote the development of breeding workPlant peptidesFermentationBiotechnologyHistiocyte
The invention discloses a method of improving a plant type of dendrocalamus latiflorus with a GRG1 gene and application of the method and belongs to the technical field of plant gene editing and dendrocalamus latiflorus breeding. In the method disclosed by the invention, a CRISPR / Cas-9 gene editing technology is utilized to perform directional editing on a gene conserved functional domain of GRG1in the dendrocalamus latiflorus, and directional knockout is performed on a genome by Cas9 proteins under the guidance of the sgRNA of a GRG1 targeted gene; by taking calluses of the dendrocalamus latiflorus as a receptor material for genetic transformation, a gene editing tool box is introduced into callus cells by an agrobacterium-mediated method for screening and identifying positive calluses;and for a transgenic dendrocalamus latiflorus plant obtained through the callus differentiation process, a positive plant subjected to genetic transformation is identified, the targeting gene editingcondition is determined, and finally, a dendrocalamus latiflorus plant line with GRG1 gene function deletion and accelerated growth is obtained.
Owner:FUJIAN AGRI & FORESTRY UNIV

Amplification primer and amplification method of complete mitochondrial genome sequence of nibea miichthioides chu

The invention discloses an amplification primer and an amplification method of a complete mitochondrial genome sequence of nibea miichthioides chu. The amplification primer comprises 4 klenow fragment amplification primer pairs and 19 genome walking primers. According to the amplification primer and the amplification method provided by the invention, the complete mitochondrial genome sequence of nibea miichthioides chu, which is obtained by conducting PCR amplification on genome of the nibea miichthioides chu, can provide a material base for conservation genetics and evolutionary genetics of the nibea miichthioides chu and for marker-assisted selection of high-quality breeding varieties.
Owner:MARINE FISHERIES RES INST OF ZHEJIANG

Dual PCR method for detecting theileria hirci and anaplasma

The invention relates to a dual PCR method for detecting theileria hirci and anaplasma. The method includes the steps of finding a gene conserved seuqnece target gene locus and designing a specific primer sequence I according to the 18S rRNA gene sequence of theileria hirci, finding a gene conserved seuqnece target gene locus and designing the specific primer sequence II according to the 16S rRNA gene sequence of anaplasma, adding the upstream primer and the downstream primer of the specific primer sequence I and the upstream primer and the downstream primer of the specific primer sequence II and PCR mixed liquid into a PCR pipe, mixing the materials and adding theileria hirci DNA and anaplasma DNA extracted from a to-be-tested blood sample to the mixture, putting the PCR pipe into a PCR amplification instrument to be circulated, obtaining a PCR product, and putting the PCR product on 2% sepharose gel to be subjected to electrophoresis. The method has the advantages of being rapid, specific, sensitive, efficient, low in cost and the like and is beneficial to clinical application.
Owner:HENAN AGRICULTURAL UNIVERSITY

LAMP primer group for rapidly detecting peach branch blight bacteria, and rapid detection method and kit thereof

The invention belongs to the technical field of plant disease control, and discloses a loop-mediated isothermal amplification (LAMP) primer group for detecting peach branch blight bacteria, and a rapid detection method and a kit thereof. The primer group comprises a pair of outer primers F3 and B3 and a pair of inner primers FIP and BIP. The invention also discloses a LAMP kit for detecting peach branch blight bacteria. The kit comprises the primer group, 10 * Thermopol Buffer, dNTPs, MgSO4, betaine and Bst DNA polymerase. The LAMP primers are designed according to the MTEF1 gene conserved region fragment sequence, and the rapid molecular detection system and reaction conditions are optimized, so that the LAMP detection can be performed on the peach branch blight bacteria; and the method has the advantages of simple reaction process, short detection period, high specificity and high sensitivity, can be used for observing the detection result with naked eyes, and has wide application prospects.
Owner:YANGZHOU UNIV

Digital PCR detection kit and digital PCR detection method for mutation detection of gene mutation high-incidence region

The invention discloses a digital polymerase chain reaction (PCR) detection kit and a digital PCR detection method for mutation detection of a gene mutation high-incidence region. The kit comprises apair of amplification primers, a wild-type specificity detection probe and a internal control probe; the amplification primers are used as a universal PCR amplification upstream primer and a universalPCR amplification downstream primer for detecting a plurality of mutation sites in a gene mutation high-incidence region, and an amplification region comprises a gene mutation high-incidence region to be detected; the wild-type specificity detection probe aims at the gene mutation high-incidence region; and the internal control probe aims at a gene conservative sequence in the amplification region of the gene mutation high-incidence region, wherein different fluorescent dyes are marked by the wild-type specificity detection probe and the internal control probe. The kit and the method can be used to distinguish the wild type and the mutant type of the gene mutation high-incidence region, can further determine the specific mutant type according to a positive signal position of the probes, and can realize quantification of various different mutant types to determine proportions of various mutations.
Owner:TARGETINGONE CORP +1

Method for quickly detecting pathogenic aeromonas hydrophila by multiple polymerase chain reactions (PCRs)

The invention relates to a method for quickly detecting pathogenic aeromonas hydrophila by multiple polymerase chain reactions (PCRs). The method comprises the steps of: designing three pairs of primers by using aeromonas hydrophila 16rDNA (Ribosomal deoxyribonucleic acid) gene conservation region sequence, ectotoxin gene and quorum-sensing signal gene sequence, and building the quick detection method by the multiple PCRs. The method is high in specificity, convenient to operate, low in detection cost and short in time, can be used for detecting a large batch of samples at the same time and can be standardized into a product, thus meeting the demand of an inspection and quarantine department which needs to detect the pathogenic aeromonas hydrophila of aquatic animals on a large scale.
Owner:中华人民共和国江苏出入境检验检疫局 +1

Diagnostic Primers and Method for Detecting Avian Influenza Virus Subtype H5 and H5n1

InactiveUS20080261198A1Rapid and specific and sensitiveLower risk of cross-contaminationSugar derivativesNucleotide librariesAvian influenza virusGene
The present invention provides primers directed to conserved regions of the HA and NA genes of avian influenza virus subtypes H5 or H5N1, and provides a method for detecting avian influenza subtype H5 or H5N1.
Owner:AGENCY FOR SCI TECH & RES

Mandarin fish infectious splenorenal necrosis virogene diagnostic kit and detecting method thereof

The present invention is mandarin fish infectious spleen and kidney necrosis virus gene diagnosing kit and its usage. The kit and its usage is designed based on two pairs of primers for the conservation sequence of mandarin fish infectious spleen and kidney necrosis virus gene. By means of PCR technology, the present invention detects qualitatively the specific DNA nucleic acid segment of mandarin fish infectious spleen and kidney necrosis virus fast, simply, specifically and sensitively. The present invention may be used in the tracing detection of different stages of mandarin fish cultivation and environment monitoring.
Owner:SUN YAT SEN UNIV

Method for storing Rhinopithecus roxellana feces sample for DNA extraction

InactiveCN107586772AEffective preservationGuaranteed withdrawalDNA preparationRhinopithecus roxellanaConservation genetics
The invention relates to a method for storing a Rhinopithecus roxellana feces sample for DNA extraction. The method specifically comprises the following steps: (1) the feces sample is placed in a 15mlcollection tube, silica gel is contained in the collection tube, and sterile filter paper is spread on the surface of the silica gel; (2) the collection tube is stored in a refrigerator at the temperature of subzero 20 DEG C. The feces sample can be stored simply, accurately and effectively with the method, and guarantee is provided for research in genetic diversity, conservation genetics and thelike for Rhinopithecus roxellana.
Owner:INST OF FOREST ECOLOGY ENVIRONMENT & PROTECTION CHINESE ACAD OF FORESTRY

Cold-adapted I-type 5-enolpyruvoyl shikimic acid-3-phosphate synthase gene

The invention belongs to the technical field of microbial genetic engineering, and particularly relates to a cold-adapted I-type 5-enolpyruvoyl shikimic acid-3-phosphate synthase gene. The nucleotidesequence of the I-type 5-enolpyruvylshikimic acid-3-phosphate synthase (EPSPS) gene is as represented by SEQ ID NO: 1 in a sequence table, and the sequence of a protein encoded by the gene is as represented by SEQ ID NO: 2. The cold-adapted I-type 5-enolpyruvoyl shikimic acid-3-phosphate synthase gene is obtained by cloning according to an aroA gene conserved sequence of Isoptericola sp. GR1TH_0001 reported in Genbank. Biological tests prove that the enzyme has high tolerance to glyphosate and has unique low-temperature adaptability.
Owner:HUAZHONG AGRI UNIV

Nested PCR kit and method for detecting double-RNA viruses of micropterus salmoides

ActiveCN112322789ABroadcast monitoringExclude the risk of transmissionMicrobiological testing/measurementClimate change adaptationConserved sequenceVirus diseases
The invention relates to the technical field of double-RNA virus detection, in particular to a nested PCR kit and method for detecting double-RNA viruses of micropterus salmoides. The kit comprises two pairs of nested PCR primers, wherein the sequences of the two pairs of nested PCR primers are that F1 of 5'-CAGAAGGACCGATTCAACTCACT-3', R1 of 5'- CTCTGGTGAGGAGGTAGTAGGCAA-3', F2 of 5'-CCTGTCGTGCGGGCTCCTATT-3', and R2 of 5'- CTCTTTGTGGCGTTGGCTTCG-3'. According to the nested PCR kit, aiming at LBBV, the VP1 conserved gene sequence of LBBV is taken as a target to establish a nested PCR detection method, and a quick and sensitive detection means is provided for early warning and effective prevention and control of the virus disease.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI