Patents
Literature
Patsnap Copilot is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Patsnap Copilot

79 results about "Gene conservation" patented technology

Conservation genetics is an interdisciplinary subfield of Population Genetics that aims to understand the dynamics of genes in populations principally to avoid extinction.

Method for simultaneously detecting twelve kinds of common respiratory viruses

The invention discloses a method for simultaneously detecting twelve kinds of common respiratory viruses. According to the method, primers and probes are designed according to gene conservative areas of the twelve kinds of common respiratory viruses, namely influenza A virus, influenza B virus, influenza C virus, parainfluenza virus type 1, parainfluenza virus type 2, parainfluenza virus type 3, rhinovirus, Bocavirus, adenovirus, coronavirus, metapneumovirus and respiratory syncytial virus, nucleic acid fragments of samples to be measured are extracted for amplifying, and finally, the samples are separated by using a capillary electrophoresis method. The method disclosed by the invention has the advantages of low required sample size, high sensitivity and accuracy, good specificity and low cost; the defects that the conventional single tube multiplex fluorescence PCR (Polymerase Chain Reaction) detection primers are difficult to design, and multicolor fluorescence mutually intervenes and is not easy to part are overcome, the defects that a chip detection method is tedious in operation, high in detection cost and the like are also overcome, and a new method is provided for screening the respiratory viruses.
Owner:FUJIAN INT TRAVEL HEALTH CARE CENT +1

LAMP primer group for detecting phytoplasma as well as kit of LAMP primer group and application of kit

The invention discloses an LAMP primer group for detecting phytoplasma as well as a kit of the LAMP primer group and an application of the kit. The LAMP primer group, which is strong in specificity and is constituted by nucleotide sequences shown as SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5, is finally obtained by designing six groups of primers for six regions of the conserved sequence of a 16S gene of 16SrI group phytoplasma and designing two groups of primers for six regions of the conserved sequence of a tuf gene of the 16SrI group phytoplasma. The invention further discloses the kit of paulownia witch phytoplasma, Chinaberry witch phytoplasma, mulberry dwarf phytoplasma, lettuce yellow phytoplasma and catharanthus roseus green phytoplasma prepared by virtue of the primer group and the invention also establishes a detection method; the detection method has the advantages of being good in stability, strong in specificity, high in sensitivity and the like; and the method is applicable to the detection of the paulownia witch phytoplasma, the Chinaberry witch phytoplasma, the mulberry dwarf phytoplasma, the lettuce yellow phytoplasma and the catharanthus roseus green phytoplasma.
Owner:INST OF FOREST ECOLOGY ENVIRONMENT & PROTECTION CHINESE ACAD OF FORESTRY

Primer, probe and kit for detecting mutation of human JAK2 gene V617F

The invention discloses a primer, a probe and a kit for detecting a mutation of a human JAK2 gene V617F. The primer comprises a mutation forward primer JW1-F and a mutation reverse ARMS primer JM1-R, and the probe comprises a detection probe JW1-P and a blocking probe JW1-B, wherein the mutation forward primer JW1-F is combined with a JAK2 gene conserved sequence; the mutation reverse ARMS primer JM1-R is specifically combined with a V617F (1849G>T) site mutation sequence to selectively amplify the mutation sequence; a 5minute end of the detection probe JW1-P is marked with an FAM (carboxy fluorescein) signal; a 3minute end of the detection probe is marked with an MGB (Minor Groove Binder); the detection probe JW1-P can be combined with an amplified fragment; a 5minute end of the blocking probe JW1-B is double-deoxidized and modified; a 3minute end of the blocking probe JW1-B is marked with the MGB; the blocking probe JW1-B can be specifically combined with a V617 site wild-type sequence to inhibit wild-type nonspecific amplification. The primer and the probe which are disclosed by the invention are high in specificity and good in sensitivity, and have high detectability of 1 percent. The kit prepared from the primer and the probe is accurate in detection result and easy in reading of the detection result, is simple and rapid to operate, and is wide in application range.
Owner:武汉海吉力生物科技有限公司

Siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) inactivation rapid detection kit and detection method

The invention discloses a siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) inactivation rapid detection kit and a detection method. The detection kit and the detection method can monitor weather ISKNV is inactivated through detection of mRNA virus, specific steps are as follows: 7 days after an inactivated vaccine semi-finished product or finished product is inoculated with CPB cells, total cellular RNA is extracted, DNA residues are removed, reverse transcription is performed, a specific primer and a specific probe designed according to a siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV) ORF099 gene conservation region sequence are used for fluorescence quantitative PCR reaction, and weather the ISKNV is completely inactivated can be determined according to a reaction result. The detection kit and the detection method can be used for rapid detection of siniperca chuatsi infectious spleen and kidney necrosis virus, can simplify inactivation inspection operation procedures of the ISKNV cell inactivated vaccine, shortens the test cycle, saves the cost, improves the sensitivity of the inactivation inspection, and improves vaccine production efficiency.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Taqman probe fluorescent quantitative PCR detection kit for identifying canine distemper virus wild strain and vaccine strain as well as application thereof

PendingCN108842003ARapid infectionDifferential Diagnosis TaqMan Probe Fluorescent Quantitative PCR Method SpecificMicrobiological testing/measurementMicroorganism based processesCanine distemper virus CDVPcr method
The invention discloses a Taqman probe fluorescent quantitative PCR detection kit for identifying a canine distemper virus wild strain and a vaccine strain as well as application thereof. The kit comprises a universal primer for amplifying a canine distemper virus wild strain and vaccine strain H gene conservation area as well as a specific probe for identifying a canine distemper virus wild strain or a vaccine strain. The experiment proves that the Taqman probe fluorescent quantitative PCR detection kit is used for detecting and identifying the CDV wild strain and the vaccine strain, the sensitivity can reach to 1 copy; 103 to 102 copies with the virus quantity as low as 1 TCID50/mL and higher than that of the conventional method can be detected; and through detection on five kinds of other pathogen nucleic acid, the copies are negative. Therefore, the kit for identifying the CDV wild strain and the vaccine strain has the characteristics of high specificity, high sensitivity and highstability, and can rapidly identify canine distemper virus wild strain and vaccine strain infection.
Owner:INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS

Methods for acquiring micro-satellite sequence and polymorphic micro-satellite markers of hucho taimen and polymorphic micro-satellite markers of hucho taimen

The invention discloses methods for acquiring a micro-satellite sequence and polymorphic micro-satellite markers of hucho taimen and the polymorphic micro-satellite markers of the hucho taimen, which relate to a method for acquiring the micro-satellite sequence and the polymorphic micro-satellite markers and the polymorphic micro-satellite markers. The method for acquiring the micro-satellite sequence comprises the following steps: firstly, extracting a hucho taimen genome DNA; secondly, performing enzyme cutting on the hucho taimen genome DNA and constructing a micro-satellite enrichment library; and thirdly, performing colony PCR amplification and performing positive clone detection and sequencing. The method for acquiring the polymorphic micro-satellite markers of the hucho taimen comprises the following steps: performing the first step to the third step the same as that of the method for acquiring the micro-satellite sequence; fourthly, analyzing the micro-satellite sequence of the hucho taimen and designing a primer; and fifth, performing polymorphic identification on the primer of the micro-satellite sequence. The method acquires seven pairs of the polymorphic micro-satellite markers of the hucho taimen. The biological materials obtained by the methods can be used for conservation genetics, genetic relationship analysis, linkage map construction and genetic management of cultured populations of the hucho taimen.
Owner:HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI

Kit and detection method for detecting vibrio harveyi

The invention relates to a kit and detection method for detecting vibrio harveyi by using the loop-mediated isothermal amplification technique. The kit comprises a loop-mediated isothermal amplification reaction solution, a Bst DNA (deoxyribonucleic acid) polymerase and a color-developing agent, wherein the reaction solution contains a reaction buffering solution Thernopol, dNTP (deoxyribonucleotide triphosphate), MgSO4, a forward inter primer (Vh-FIP) TTCGCTTTCGCGAGCCATCTGGTTACCAATTGATCGCCCG, a reverse inter primer (Vh-BIP) ACGCAGAATCAAGCAGTGTGCCGATTTATTCGCCACGACA, a forward outer primer (Vh-F3) CAAAACGGTTCCGAAACGC, a reverse outer primer (Vh-B3) TCGATTCCCCAAGTTTGGAG, a betaine, and sterile distilled water. The detection method comprises the following steps: extracting bacterium DNAs, carrying out loop-mediated isothermal amplification, carrying out color-developing detection and the like. By designing the primers according to the vibrio harveyi toxR gene conservation area and detecting by using the LAMP (loop-mediated isothermal amplification) technique, the invention achieves high specificity and high sensitivity; the kit has the advantages of high detection speed, high accuracy, excellent sensitivity, convenient on-site application and the like; and the defects of long cycle, low sensitivity, high cost, difficult on-site application and the like in the prior art are solved.
Owner:陈吉刚

Primer set for performing fluorescence quantitative PCR detection on decapod iridescent virus 1 ( Decapod iridescent virus 1, DIV1 ) and reagent kit

The invention discloses a primer set for performing fluorescence quantitative PCR detection on decapod iridescent virus 1 ( Decapod iridescent virus 1, DIV1 ) and a reagent kit, and belongs to the technical field of virus detection. The primer set specifically comprises a primer for detecting the decapod iridescent virus 1 and a TaqMan-MGB probe, and a reagent kit based on the detection primer andthe probe. Through the primer set disclosed by the invention, according to an MCP gene consensus sequence of DIV1, a specific primer and the TaqMan-MGB probe are designed, a recombinant plasmid standard product pMD18-T-MCPDIV1 is prepared, a TaqMan-MGB probe fluorescence quantitative PCR method for detecting DIV1 is established, the TaqMan-MGB probe fluorescence quantitative PCR method has the advantages of being high in sensitivity, high in specificity, good in repeatability, wide in quantitative range, simple and quick and the like; and a corresponding detection reagent kit is researched and developed, and popularization and application are convenient, so that quick quantitative detection of the DIV1 and the prevention and control of relevant diseases are facilitated.
Owner:GUANGXI ACADEMY OF FISHERY SCI

Digital PCR detection kit and digital PCR detection method for mutation detection of gene mutation high-incidence region

The invention discloses a digital polymerase chain reaction (PCR) detection kit and a digital PCR detection method for mutation detection of a gene mutation high-incidence region. The kit comprises apair of amplification primers, a wild-type specificity detection probe and a internal control probe; the amplification primers are used as a universal PCR amplification upstream primer and a universalPCR amplification downstream primer for detecting a plurality of mutation sites in a gene mutation high-incidence region, and an amplification region comprises a gene mutation high-incidence region to be detected; the wild-type specificity detection probe aims at the gene mutation high-incidence region; and the internal control probe aims at a gene conservative sequence in the amplification region of the gene mutation high-incidence region, wherein different fluorescent dyes are marked by the wild-type specificity detection probe and the internal control probe. The kit and the method can be used to distinguish the wild type and the mutant type of the gene mutation high-incidence region, can further determine the specific mutant type according to a positive signal position of the probes, and can realize quantification of various different mutant types to determine proportions of various mutations.
Owner:TARGETINGONE CORP +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products