Supercharge Your Innovation With Domain-Expert AI Agents!

LAMP primer group for rapidly detecting peach branch blight bacteria, and rapid detection method and kit thereof

The technology of a blight bacteria and a kit is applied to the detection of primer sets of peach blight bacteria and the field of rapid detection, which can solve the problems of human harm, laboratory personnel health injury, pollution and the like

Active Publication Date: 2021-04-13
YANGZHOU UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] With the continuous development of nucleic acid-related identification methods, the method based on common PCR has been successfully used to detect Peach Branch Blight, but the detection of PCR specificity takes a long time and takes 3 to 4 hours. At the same time, the PCR method requires an expensive PCR machine. And the detection sensitivity is low, and the process is complicated
In addition, the gel electrophoresis of the product by ordinary PCR reaction can easily cause product amplification, which is an important source of laboratory pollution, and ethidium bromide (EB) is highly toxic, can accumulate and cause cancer, and cause great harm to the human body. Observing the ultraviolet light will also cause a certain degree of harm to the health of the experimenters

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primer group for rapidly detecting peach branch blight bacteria, and rapid detection method and kit thereof
  • LAMP primer group for rapidly detecting peach branch blight bacteria, and rapid detection method and kit thereof
  • LAMP primer group for rapidly detecting peach branch blight bacteria, and rapid detection method and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077]Example 1: A lamp ring medlar of peach bullia is aimed.

[0078]The kit is preferably comprising a BST DNA polymerase (New England Biolabs), MGSO4(New England Biolabs), 10mm DNTPS (Takara), 5mm beet base (Solarbio), BST DNA polymerase, outer primers F3 and B3, inner primers FIP and BIP, Sybrgreen I. Targeting gene fragmentfigure 1 Each primer sequence is as follows:

[0079]Positive external primer F3: cgtccctttctgctcttcac

[0080]Reverse outer primers B3: ctatatcgagccggggagga

[0081]Positive inner primer FIP: atggaattcgggccttcgggctctctcagcatcccct

[0082]Reverse inner primers BIP: TcatctTatccCCCCCTGCGCGCAACCCGTGCTTCTC

[0083]Among them, the inner primer FIP, the reverse inner primer BIP, the forward outer primer F3, the reverse outer primer B3 constitutes a LAMP detection primer composition for detecting peach bullia.

Embodiment 2

[0084]Example 2: Specificity test of LAMP reactions in Tazhiki disease.

[0085]In order to verify the specificity of the LAMP method, the test results of 16 kinds of pathogens are tested materials, and the LAMP detection shows that the peach blister strain can observe the fluorescent green positive reaction or agarose gel electrophoresis appears LAMP stepped strips, and the remaining 14 The results of similar colony species were orange negative reactions or agarose gel electrophoresis did not appear amplified strips. DNA was selected as a template, and 1 μl of DNA solution was taken as a template, and the LAMP reaction was carried out according to Example 1, and the reaction procedure was: 65 ° C, 60 min. The results show that the reaction system-based color reaction is determined as a result of determination standard. When the peach blight DNA template, fluorescent green is presented; the DNA template and negative control of different kinds of peach bark are presented orange (figure ...

Embodiment 3

[0086]Example 3: Sensitivity Test of Ta branium LAMP reactions.

[0087]In order to determine the sensitivity of the LAMP detection method, the extracted peach bile DNA was subjected to 10 times with DEPC water with DEPC water with DEPC water, and was stored as spare. The respective concentration DNA dilutions after gradient dilution were taken as a template, and the LAMP reaction was performed in Example 1, and the reaction procedure was incubated for 60 min in a water bath ° C. Take 1 μL of amplification product, electrophoresis detection is performed at 1% agarose gel. As a result, the LAMP method can detect 6.30 × 10-3μgDNA; Sybr Green I color reaction indicates that the sensitivity of the LAMP reaction also reaches 6.30 × 10-3μgimage 3 ). Each concentration DNA dilution after gradient was carried out as a template for PCR, and the result showed that the PCR detection concentration was 6.30 × 10-1μg.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant disease control, and discloses a loop-mediated isothermal amplification (LAMP) primer group for detecting peach branch blight bacteria, and a rapid detection method and a kit thereof. The primer group comprises a pair of outer primers F3 and B3 and a pair of inner primers FIP and BIP. The invention also discloses a LAMP kit for detecting peach branch blight bacteria. The kit comprises the primer group, 10 * Thermopol Buffer, dNTPs, MgSO4, betaine and Bst DNA polymerase. The LAMP primers are designed according to the MTEF1 gene conserved region fragment sequence, and the rapid molecular detection system and reaction conditions are optimized, so that the LAMP detection can be performed on the peach branch blight bacteria; and the method has the advantages of simple reaction process, short detection period, high specificity and high sensitivity, can be used for observing the detection result with naked eyes, and has wide application prospects.

Description

Technical field[0001]The present invention relates to plant pathogen detection and plant disease prevention and treatment technology, and more particularly to a primer group and a rapid detection method and kit for detecting peach bullse.Background technique[0002]Peach bullia is an important disease that is harmful to peach trees, and the pathogen is a peach stem (PHOMOPSISAMYGDALI). In recent years, the disease has happened to happen in my country, Nanhui, Zhejiang Jiaxing, Jiangsu Wuxi and Changzhou, Sichuan Chengdu, etc., the average loss of 20% ~ 50% of the pathogenesis, some invested Taoyuan Faced with the risk of absorption. This disease can pass through mycelium in the field disease, soil surface and soil cultivated layer of levy residues, the spores are produced by a spores and spores of the spores and spores during the average temperature of 10 to 15 ° C in March. The spore begins to release from late March, and the peak is released in the late moon from May to May, and the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6844C12Q1/04C12N15/11
CPCC12Q1/6895C12Q1/6844C12Q2531/119C12Q2563/107C12Q2537/1376C12Q2565/125Y02A50/30
Inventor 纪兆林张亮杨丽娜朱峰董京萍戴慧俊金唯新
Owner YANGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More