Kit and method for quickly detecting enterotoxin generating escherichia coli

A technology of Escherichia coli and detection method, which is applied in the field of kits for rapid detection of enterotoxin-producing Escherichia coli, and can solve the problems of complicated operation and long detection time.

A technology of Escherichia coli and detection method, which is applied in the field of kits for rapid detection of enterotoxin-producing Escherichia coli, and can solve the problems of complicated operation and long detection time.

CN101974616AInactive Publication Date: 2011-02-16ORIGISSAY BIOLOGICS TECH

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for quickly detecting enterotoxin generating escherichia coli
  • Kit and method for quickly detecting enterotoxin generating escherichia coli
  • Kit and method for quickly detecting enterotoxin generating escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Embodiment 1 The primer specificity experiment of the present invention

[0091] Test materials and methods

[0092] 1 Culture of strains

[0093] (1) Take the preserved heat-labile enterotoxigenic Escherichia coli (C83902) and streak on the nutrient broth agar plate medium to isolate a single colony, and place it in an incubator at 37°C for upside-down culture for 24 hours.

[0094] (2) Pick a single colony and inoculate it into a 3ml liquid culture medium (test tube), put it into a shaker at 180rpm at 37°C for 12h.

[0095] (3) Transfer the bacteria cultured in the test tube into 120 ml of liquid culture medium and culture them under the same conditions for 12 hours, and store them at 4°C for later use.

[0096] 2 Genome Extraction

[0097] (1) Take 100 μl of bacterial culture and centrifuge at 12000 rpm for 5 minutes;

[0098] (2) Add 100 μl of sterile water, mix well, and place in a water bath at 100°C for 10 minutes, then in an ice bath for 2 minutes;

[0099]...

Embodiment 2

[0117] The sensitivity experiment of embodiment 2 primers of the present invention

[0118] According to the method of Example 1, the bacterial solution of different dilution concentrations is amplified with the primers of the present invention, and as the concentration of the bacterial solution decreases, the brightness of the specific band gradually becomes weaker until the bacterial solution is diluted to 10 -7 (the concentration dilution factor of the original bacterial solution) there are still bands, but the bacterial solution is diluted to 10 -8 When no amplification product appears (such as Figure 4 shown).

[0119] The detection sensitivity of the primer and method of the present invention is relatively high, and can be carried out in a relatively simple environment, and the requirements for samples are not high. The heat-labile enterotoxigenic Escherichia coli was directly lysed, and its suspension was collected for LAMP reaction. 3 μL of each reaction system solu...

Embodiment 3

[0120] Embodiment 3 detects the preparation of enterotoxigenic Escherichia coli kit

[0121] Components: Specific Primers:

[0122] SEQ ID NO: 1 attacatttaagagcggcgc;

[0123] SEQ ID NO: 2 ggttcctagcattagacatgcttt;

[0124] SEQ ID NO: 3 gtgtatggaataataaaaccccctaaagcaaactagttttcca;

[0125] SEQ ID NO: 4 gtgtccttcatcctttcaatggcaggtcgaagtcccgggcagtc

[0126] Reaction system: 2 μl of 0.2 μM primers 1 and 2 (SEQ ID NO: 1 and SEQ ID NO: 2), respectively;

[0127] 1.6 μM Primers 3 and 4 (SEQ ID NO: 3 and SEQ ID NO: 4) are 2 μl respectively;

[0128] 2.5mM dNTPs 4μl;

[0129] 0.8mM Betaine 5μl;

[0130] 1X Thermopol buffer 2.5μl;

[0131] Intercalator SYBR GreenI 5μl (chromogenic solution)

[0132] Kit specification: 50T / box.

[0133] kit combination two

[0134] 0.2 μM primers 1 and 2 (SEQ ID NO: 1 and SEQ ID NO: 2) are 1.5 μl respectively;

[0135] 1.6 μM Primers 3 and 4 (SEQ ID NO: 3 and SEQ ID NO: 4) are 1.5 μl respectively;

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit and a detection method for quickly detecting enterotoxin generating escherichia coli. The kit contains primers, of which the gene sequences are expressed as SEQ ID No: 1-4; and the kit can specifically amplify genes from the enterotoxin generating escherichia coli. The kit can quickly and accurately detect the food polluted by the enterotoxin generating escherichia coli, and a simple, convenient and reliable method for food production and selling supervision is provided.

Description

technical field [0001] The invention relates to a method for rapidly detecting food quality, in particular to a kit and a detection method for rapidly detecting enterotoxigenic Escherichia coli. Background technique [0002] The high frequency of food safety emergencies is a prominent feature of social public safety issues in recent years. Enterotoxigenic Escherichia coli is one of the common enteropathogenic bacteria causing food poisoning among the enteric diseases caused by food contamination. To effectively control the spread of food contamination, higher requirements are put forward for the supervision and testing of food quality. How to quickly and accurately detect pathogenic bacteria in food is the basis for controlling food safety accidents. [0003] At present, the domestic detection of enterotoxigenic E. coli still adopts the traditional method, which is cumbersome to operate and takes a long time to detect, usually 3 to 5 days. [0004] Loop-mediated isotherma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
16 Feb 2011
Publication
CN101974616A
IPC
C12Q1/10; C12Q1/68; G01N21/78; G01N21/82
Inventors
李玉锋; 何洋