Cloning and heterologous expression method of enterotoxin C2 ultra-antigen mutation protein gene

A mutant protein and heterologous expression technology, applied in the field of genetic engineering, can solve the problems of insufficient structure and function research and unclear research conclusions, and achieve the effects of convenient purification, high yield and stable production

Inactive Publication Date: 2009-05-06
SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, as a member of the Staphylococcus aureus enterotoxin family, enterotoxin C2 (SEC2) has not much research on its structure and function at home and abroad, and the existing research conclusions are not yet clear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning and heterologous expression method of enterotoxin C2 ultra-antigen mutation protein gene
  • Cloning and heterologous expression method of enterotoxin C2 ultra-antigen mutation protein gene
  • Cloning and heterologous expression method of enterotoxin C2 ultra-antigen mutation protein gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] 1) Four superantigen mutein genes of SEC2 having base sequences in sequence table SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4:

[0025] A superantigen mutein gene having the base sequence of SEQ ID NO: 1 in the sequence table:

[0026] 001 cacaaatcaa gtgagtttac tggtacgatg ggtaatatga aatatttata

[0027] 051 tgatgatcat tatgtatcag caactaaagt tatgtctgta gataaatttt

[0028] 101 tggcacatga tttaatttat aacattagtg ataaaaaact aaaaaattat

[0029] 151 gacaaagtga aaacagagtt attaaatgaa gatttagcaa agaagtacaa

[0030] 201 agatgaagta gttgatgtgtatggatcaaa ttactatgta aactgctatt

[0031] 251 tttcatccaa agataatgta ggtaaagtta caggtggtaa aacttgtatg

[0032] 301 tatggaggaa taacaaaaca tgaaggaaac cactttgata atgggaactt

[0033] 351 acaaaatgta cttataagag tttatgaaaa taaaagaaac acaatttctt

[0034] 401 ttgaagtgca aactgataag aaaagtgtaa cagctcaaga actagacata

[0035] 451 aaagctagga attttttaat taataaaaaa aatttgtatg agtttaacag

[0036] 501 ttcaccatat gaaacaggat atataaaatt tattgaaaat...

Embodiment 2

[0145] Expression of superantigen muteins

[0146] 1) Construction of protein expression vectors encoded by the four superantigen mutant proteins of SEC2: gene cloning vectors pGEM-T-SEC2-SEQ ID NO: 1, pGEM-T-SEC2-SEQ ID NO: 2, pGEM-T- SEC2-SEQ ID NO: 3, pGEM-T-SEC2-SEQ ID NO: 4 Plasmid DNA was digested with EcoRI and XhoI, and the gel recovery kits were recovered respectively. The sequence table has SEQ ID NO: 1, SEQ ID NO: 2, Four superantigen mutein genes in SEQ ID NO:3 and SEQ ID NO:4. T4 DNA ligase was used to ligate the pET-28a expression vectors that had been digested with the same double restriction enzymes respectively, and the expression vectors pET-28a-SEC2-SEQ ID NO: 1, pET-28a-SEC2-SEQ ID NO: 2, pET- 28a-SEC2-SEQ ID NO:3, pET-28a-SEC2-SEQ ID NO:4. E.coli BL21(DE3) competent cells were transformed, and the correct recombinant clones were identified by Sanger dideoxy terminal termination sequencing.

[0147] 2) Induced expression and purification of superantigen ...

Embodiment 3

[0151] Stimulated mouse spleen lymphocyte proliferation activity detection

[0152] The SPF-grade pure-line mouse Balb / c was sacrificed through the cervical spine, and the spleen was collected under aseptic conditions, crushed lightly, and passed through a 200-mesh sieve. Then the cell suspension passed through the sieve was centrifuged at 1000rpm / min for 5min to collect the cell pellet, the cells were resuspended with 5mL red blood cell lysate, left to stand for 5min and then centrifuged at 1000rpm / min for 5min. The cells were then washed 1-2 times with serum-free 1640 medium (purchased from Gibco), and finally the cell concentration was adjusted with RPMI-1640 medium containing 10% calf serum (purchased from Gibco) to 8×10 5 cells / well added to 96-well plate. The purified SEC2 four superantigen mutein gene-encoded proteins each having the amino acid sequences of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8 were respectively mixed with 40 pmol / mL of final conc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a genetic engineering technology, in particular to a superantigen mutant protein gene of enterotoxin C2 and a method for cloning, expressing and preparing the same. The superantigen mutant protein gene of the enterotoxin C2 comprises base sequences in tables of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Allogenetic expression of the superantigen mutant protein gene provides development potential of the enterotoxin C2 in the anti-tumor aspect; and the superantigen mutant protein gene performs deletion mutant on an amino terminal thereof on the basis of SEC2, the amino terminal affects the biological activity, and mutant protein kept with the superantigen activity is expected to be obtained on the basis simultaneously. The superantigen mutant protein gene of the enterotoxin C2 applied to preparing a superantigen anti-tumor biological agent has the characteristics of high yield, stable production, convenient purification and the like.

Description

technical field [0001] The invention relates to genetic engineering technology, in particular to an enterotoxin C2 superantigen mutant protein gene and a method for cloning, expressing and preparing it. Background technique [0002] Superantigen (SAg) is a group of protein molecules encoded by bacteria or viruses, which can stimulate the proliferation of most T cells at a very low concentration (1-10 ng / mL), and has a super-strong function of enhancing the body's immune response and certain anti-inflammatory effects. tumor activity. Therefore, superantigen is an excellent immunomodulator and synergist, and it is expected to be developed into a potential new antitumor drug for tumor treatment. [0003] Staphylococcal enterotoxins (SEs) are a representative class of microbial exotoxins. Because of its extremely strong T cell activation function, it has become a typical microbial superantigen and has been widely valued by people. In recent years, people have done a lot of re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/09C12N1/21C12P21/02
Inventor张成刚王小刚徐明恺张惠文苏振成
OwnerSHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI