Cloning and heterologous expression method of enterotoxin C2 ultra-antigen mutation protein gene
A mutant protein and heterologous expression technology, applied in the field of genetic engineering, can solve the problems of insufficient structure and function research and unclear research conclusions, and achieve the effects of convenient purification, high yield and stable production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] 1) Four superantigen mutein genes of SEC2 having base sequences in sequence table SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4:
[0025] A superantigen mutein gene having the base sequence of SEQ ID NO: 1 in the sequence table:
[0026] 001 cacaaatcaa gtgagtttac tggtacgatg ggtaatatga aatatttata
[0027] 051 tgatgatcat tatgtatcag caactaaagt tatgtctgta gataaatttt
[0028] 101 tggcacatga tttaatttat aacattagtg ataaaaaact aaaaaattat
[0029] 151 gacaaagtga aaacagagtt attaaatgaa gatttagcaa agaagtacaa
[0030] 201 agatgaagta gttgatgtgtatggatcaaa ttactatgta aactgctatt
[0031] 251 tttcatccaa agataatgta ggtaaagtta caggtggtaa aacttgtatg
[0032] 301 tatggaggaa taacaaaaca tgaaggaaac cactttgata atgggaactt
[0033] 351 acaaaatgta cttataagag tttatgaaaa taaaagaaac acaatttctt
[0034] 401 ttgaagtgca aactgataag aaaagtgtaa cagctcaaga actagacata
[0035] 451 aaagctagga attttttaat taataaaaaa aatttgtatg agtttaacag
[0036] 501 ttcaccatat gaaacaggat atataaaatt tattgaaaat...
Embodiment 2
[0145] Expression of superantigen muteins
[0146] 1) Construction of protein expression vectors encoded by the four superantigen mutant proteins of SEC2: gene cloning vectors pGEM-T-SEC2-SEQ ID NO: 1, pGEM-T-SEC2-SEQ ID NO: 2, pGEM-T- SEC2-SEQ ID NO: 3, pGEM-T-SEC2-SEQ ID NO: 4 Plasmid DNA was digested with EcoRI and XhoI, and the gel recovery kits were recovered respectively. The sequence table has SEQ ID NO: 1, SEQ ID NO: 2, Four superantigen mutein genes in SEQ ID NO:3 and SEQ ID NO:4. T4 DNA ligase was used to ligate the pET-28a expression vectors that had been digested with the same double restriction enzymes respectively, and the expression vectors pET-28a-SEC2-SEQ ID NO: 1, pET-28a-SEC2-SEQ ID NO: 2, pET- 28a-SEC2-SEQ ID NO:3, pET-28a-SEC2-SEQ ID NO:4. E.coli BL21(DE3) competent cells were transformed, and the correct recombinant clones were identified by Sanger dideoxy terminal termination sequencing.
[0147] 2) Induced expression and purification of superantigen ...
Embodiment 3
[0151] Stimulated mouse spleen lymphocyte proliferation activity detection
[0152] The SPF-grade pure-line mouse Balb / c was sacrificed through the cervical spine, and the spleen was collected under aseptic conditions, crushed lightly, and passed through a 200-mesh sieve. Then the cell suspension passed through the sieve was centrifuged at 1000rpm / min for 5min to collect the cell pellet, the cells were resuspended with 5mL red blood cell lysate, left to stand for 5min and then centrifuged at 1000rpm / min for 5min. The cells were then washed 1-2 times with serum-free 1640 medium (purchased from Gibco), and finally the cell concentration was adjusted with RPMI-1640 medium containing 10% calf serum (purchased from Gibco) to 8×10 5 cells / well added to 96-well plate. The purified SEC2 four superantigen mutein gene-encoded proteins each having the amino acid sequences of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8 were respectively mixed with 40 pmol / mL of final conc...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com