Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genotyping detection method of drug resistance to Sanmate of Fusarium graminearum

A technology of Fusarium graminearum and drug resistance, which is applied in the field of genotyping and detection of Fusarium graminearum resistance to carbendazim, and can solve the problem of time-consuming, heavy workload, and inability to predict the prevalence of drug-resistant diseases at an early stage. And other issues

Inactive Publication Date: 2013-06-26
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional resistance detection method is based on the inhibitory effect of different doses of chemicals on the growth of mycelium to identify drug resistance, which takes a long time, and the workload of determining the level of drug resistance is greater, and it is impossible to predict the prevalence of drug-resistant diseases in the early stage

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genotyping detection method of drug resistance to Sanmate of Fusarium graminearum
  • Genotyping detection method of drug resistance to Sanmate of Fusarium graminearum
  • Genotyping detection method of drug resistance to Sanmate of Fusarium graminearum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1. Detection of genotypic strains with point mutations at codon 167 (position 167)

[0049] Extract the genomic DNA of strains ZF-43, ZF-21, ZF-52, R9, and amplify the pair of specific primers that amplify the DNA fragment of Fusarium graminearum β2-tubulin gene containing 167 codons:

[0050] F-out167 5′GACCACCTTCAGGGTTTCCAGCTGACGC3′

[0051] R-out167 5′GATCGGCGTACGAAGGATCGGCGATCTT3′

[0052] F-in167T 5′GTTCCCCGATCGCATGATGGCCACTTT3′

[0053] R-in167A 5′GAAACCTTGGGCGAGGGCATAACGGGAT3′

[0054] 25μl PCR system contains 2μl of DNA template, 2.5μl 10×buffer, 2μl dNTP (2.5mM each), 1.5μl MgCl2 (25mM), 0.2μl each of F-out167 / R-out167 (10μM), 0.5μl of F-in167T (10μM), R-in167A (10μM) 0.8μl, TaqDNA polymerase 1U (Dalian Biotech, Takara). The reaction was carried out on PTC-200 (Bio-rad, Inc.), reaction conditions: 94°C for 5 min; 94°C for 15s, 66°C for 30s, 72°C for 30s, 35 cycles; 72°C for 5min; 4°C storage. Take 8μl of PCR product on 2% agarose TBE gel for electrophoresis, ob...

Embodiment 2

[0056] Example 2. Detection of genotypic strains with point mutations at codon 198 (position 198)

[0057] The genomic DNA of the strains ZF43, ZF-21, J2, ZF43-6 was extracted, and a pair of specific primers were used to amplify the DNA fragment containing the 198 codon of the β2-tubulin gene of Fusarium graminearum:

[0058] F-out198 5'AGCTCGTTGAGGAAGCCATTGATGTT3'

[0059] R-out198 5′CATGTTAACAGCGAGCTTTCGCAGAT3′

[0060] F-in198A 5′GAACCAGCTCGTCGAGAACTCTGCCA3′

[0061] R-in198G 5′GAGCCTCGTTATCGATACAGAAGGTATC3′

[0062] 25μl PCR system contains 2μl of DNA template, 2.5μl 10×buffer, 2μldNTP (2.5mM each), 1.5μl MgCl2 (25mM), 0.4μl each of F-out198 / R-out198 (10μM), F-in198A (10μM) 0.15μl, R -in198G 0.4μl, TaqDNA polymerase 1U (Dalian Biotech, Takara). The reaction was carried out on PTC-200 (Bio-rad, Inc.) under the reaction conditions: 94°C for 5 min; 94°C for 15s, 65°C for 30s, 72°C for 30s, 35 cycles; 72°C for 5min; 4°C storage. Take 8μl of PCR product and electrophoresis on 2% agaros...

Embodiment 3

[0064] Example 3. Detection of genotypic strains with point mutations at codon 200 (position 200)

[0065] The genomic DNA of the strains ZF43, ZF-21, NT-7, t1 was extracted, and a pair of specific primers were used to amplify the DNA fragment containing 200 codons of β2-tubulin gene of Fusarium graminearum:

[0066] F-out200 5′ACAACTGGGCCAAGGGTCATTACACC3′

[0067] R-out200 5′AAGTCGGGGGAACGGAATCATGTTAAC3′

[0068] F-in200T 5'CCAGCTCGTCGAGAACTCTGACGAGACTTT3'

[0069] R-in200A 5′TCGTACAGAGCCTCGTTATCGATACGGT3′

[0070] 25μl PCR system contains 2μl of DNA template, 2.5μl 10×buffer, 2μl dNTP (2.5mM each), 1.5μl MgCl2 (25mM), 0.8μl each of F-out200 / R-out200 (10μM), F-in200T / R-in200A (10μM) ) 0.5 μl each, 1 U of Taq DNA polymerase (Dalian Bao Biological, Takara). The reaction was carried out on PTC-200 (Bio-rad, Inc.) under reaction conditions: 94°C for 5 min; 94°C for 15s, 55°C for 30s, 72°C for 30s, 35 cycles; 72°C for 5 minutes; 4°C storage. Take 8μl of PCR product on 2% agarose TBE gel f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to a Sanmate resistance genotype molecular detection and SNP typing method of Fusarium graminearum, which can be used for drug resistance monitoring and drug resistance genotype diagnosis to Sanmate and other benzimidazole type bactericides of the Fusarium graminearum which can cause wheat scab. The detection method comprises the following three major steps: (1) extracting DNA of a nuclear genome of a strain to be detected; (2) applying three groups of primer pairs to carry out PCR reaction; and (3) identifying the genotype of the strain with the resistance to the Sanmate according to a PCR product electrophoretogram. By adopting the Tetra-primer ARMS PCR (Tetra-primer amplification refractorymutation system-PCR) technology, the strain with the drug resistance of theFusarium graminearum and the genotype thereof can be fast and accurately detected, and the level of the drug resistance can be further judged. The detection accuracy is above 95%.

Description

1. Technical Field [0001] The present invention belongs to a molecular detection and SNP typing method for the genotype of a carbendazim-resistant strain of Fusarium graminearum, which can be used for the diagnosis and diagnosis of benzimidazole fungicide (carbendazim)-resistant Fusarium graminearum Dynamic monitoring of the development of drug-resistant pathogen groups, prediction of wheat head blight epidemics with different resistance levels; and SNP typing can provide molecular-level theoretical basis for drug resistance management. 2. Technical background [0002] Wheat head blight is a worldwide disease caused by Fusarium graminearum Schwabe, which seriously affects the yield and quality of wheat. For a long time, benzimidazole fungicides or compounding agents based on such agents have been used for chemical control. Benzimidazole fungicides are used in production as a class of high-efficiency and broad-spectrum systemic fungicides, which solve the environmental toxicity p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 周明国陈长军王建新罗卿权
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com