Vector for preparing fibrin-genetic-modification adenovirus and construction method thereof
A technology of fibrin and genetic modification, applied in botany equipment and methods, biochemical equipment and methods, using vectors to introduce foreign genetic material, etc., to achieve the effect of simple means, high efficiency, and periodical preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] In this example, the vector for preparing the adenovirus genetically modified by fibrin is as follows:
[0033] In addition to carrying the eGFP reporter gene in the E1 region, a CMV-eGFP-SV40pA expression element is inserted between 352bp and 3326bp of the adenovirus genome. The sequence of the expression element is as follows:
[0034] AGCCTGCAGGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATA
[0035] ATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACT
[0036] TGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCC
[0037] CAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTG
[0038] GCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTT
[0039] GTTTTGGCACCAAAATCAACGGGACTTTCCAAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGT
[0040] ACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATGGTACCGTTTAAACTCGAGGTCGACGGTATCGA
[0041...
Embodiment 2
[0077] In this example, the vector for preparing the adenovirus genetically modified by fibrin is as follows:
[0078]In Example 1, in addition to carrying the eGFP reporter gene in the E1 region, the eGFP reporter gene inserted into the CMV-eGFP-SV40pA expression element between 352bp and 3326bp of the adenovirus genome was replaced with Beta-Gal. The other structures of the elements are the same as those in Example 1, which constitute the vector for preparing the adenovirus genetically modified by fibrin.
[0079] Its construction method is the same as in Example 1.
Embodiment 3
[0081] In this example, the vector for preparing the adenovirus genetically modified by fibrin is as follows:
[0082] In Example 1, in addition to carrying the eGFP reporter gene in the E1 region, the eGFP reporter gene inserted into the CMV-eGFP-SV40pA expression element between 352bp and 3326bp of the adenovirus genome was replaced with luciferase. The other structures of the elements are the same as those in Example 1, which constitute the vector for preparing the adenovirus genetically modified by fibrin.
[0083] Its construction method is the same as in Example 1.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com