Vector for preparing fibrin-genetic-modification adenovirus and construction method thereof

A technology of fibrin and genetic modification, applied in botany equipment and methods, biochemical equipment and methods, using vectors to introduce foreign genetic material, etc., to achieve the effect of simple means, high efficiency, and periodical preparation

Inactive Publication Date: 2011-09-07
SHAANXI NORMAL UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] A technical problem to be solved by the present invention is to overcome the shortcomings of the current methods for preparing adenovirus vectors genetically modified by fibrin, and provide a vector for preparing adenovirus vectors genetically modified by fibrin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector for preparing fibrin-genetic-modification adenovirus and construction method thereof
  • Vector for preparing fibrin-genetic-modification adenovirus and construction method thereof
  • Vector for preparing fibrin-genetic-modification adenovirus and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] In this example, the vector for preparing the adenovirus genetically modified by fibrin is as follows:

[0033] In addition to carrying the eGFP reporter gene in the E1 region, a CMV-eGFP-SV40pA expression element is inserted between 352bp and 3326bp of the adenovirus genome. The sequence of the expression element is as follows:

[0034] AGCCTGCAGGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATA

[0035] ATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACT

[0036] TGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCC

[0037] CAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTG

[0038] GCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTT

[0039] GTTTTGGCACCAAAATCAACGGGACTTTCCAAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGT

[0040] ACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATGGTACCGTTTAAACTCGAGGTCGACGGTATCGA

[0041...

Embodiment 2

[0077] In this example, the vector for preparing the adenovirus genetically modified by fibrin is as follows:

[0078]In Example 1, in addition to carrying the eGFP reporter gene in the E1 region, the eGFP reporter gene inserted into the CMV-eGFP-SV40pA expression element between 352bp and 3326bp of the adenovirus genome was replaced with Beta-Gal. The other structures of the elements are the same as those in Example 1, which constitute the vector for preparing the adenovirus genetically modified by fibrin.

[0079] Its construction method is the same as in Example 1.

Embodiment 3

[0081] In this example, the vector for preparing the adenovirus genetically modified by fibrin is as follows:

[0082] In Example 1, in addition to carrying the eGFP reporter gene in the E1 region, the eGFP reporter gene inserted into the CMV-eGFP-SV40pA expression element between 352bp and 3326bp of the adenovirus genome was replaced with luciferase. The other structures of the elements are the same as those in Example 1, which constitute the vector for preparing the adenovirus genetically modified by fibrin.

[0083] Its construction method is the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a vector for preparing fibrin-genetic-modification adenovirus. An expression element which carries reporter genes at an E1 area is inserted between the 352bp and 3326bp of an Ad5 adenovirus genome; the original BamHI of the Ad5 adenovirus genome is mutated from the original G to C, the BamHI locus GGATCC is changed into a sequence CGATCC; two single endonuelease sites are introduced into an HI Ioop of the Ad5 adenovirus genome fibrin, two single endonuelease sites are introduced into the C tail end of the Ad5 adenovirus genome fibrin; an expression element used for screening is inserted between the two single endonuelease sites of the Ad5 carrier. The construction method comprises the following steps: construction of an adenovirus plasmid vector carrying CMV-eGFP-SV40 pA expression frame in the E1 area, construction of an adenovirus plasmid vector featuring BamHI locus mutation, preparation of an adenovirus fibrin genetically modified shuttle vector and preparation of a vector for preparing fibrin genetically modified adenovirus.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a rapid preparation of an adenovirus vector genetically modified by fibrin and a construction method thereof technical background [0002] Adenoviral vectors have broad application prospects in gene therapy and are currently one of the most commonly used viral vectors in gene therapy. Adenoviruses infect cells primarily by interacting with the adenovirus receptor (CAR) on the surface of target cells. However, many tumor cells and certain tissues (such as nerve cells, lymphocytes, etc.) lack adenovirus receptors, thus limiting the gene therapy effect of adenovirus vectors (Ad5). Genetic modification of adenoviral fiber protein (such as genetic modification of Knob protein HI loop and C-terminal) can improve the infection efficiency of adenoviral vectors on cells lacking adenoviral receptors, thereby improving gene transfer efficiency and enhancing the effect of gene thera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/66
Inventor夏海滨王东阳
OwnerSHAANXI NORMAL UNIV