Method for detecting gene polymorphism SNP (single nucleotide polymorphism) site by utilizing cyclization of RNase H (ribonuclease H)

A gene polymorphism and site technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems such as inactivation and instability, and achieve intuitive data, easy analysis, and fast and accurate results

Inactive Publication Date: 2011-09-14
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the disadvantage of linear RNase H is that it tends to become unstable or even inactivated at higher reaction temperatures in PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting gene polymorphism SNP (single nucleotide polymorphism) site by utilizing cyclization of RNase H (ribonuclease H)
  • Method for detecting gene polymorphism SNP (single nucleotide polymorphism) site by utilizing cyclization of RNase H (ribonuclease H)
  • Method for detecting gene polymorphism SNP (single nucleotide polymorphism) site by utilizing cyclization of RNase H (ribonuclease H)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Identification of the 274th Nucleotide of Human Leukocyte Antigen (HLA)

[0045] In this embodiment, the SNP site to be tested is the 274th nucleotide species of the human leukocyte antigen HLA, the cyclized RNaseH is APE RNase HII, and the probes in the example are C probes and mismatches that match the DNA to be tested. the U probe.

[0046] The first step is to purify the linear APE RNaseHII containing oligoglycine at the N-terminal and the recognition sequence of transpeptidase SortaseA at the C-terminal. The specific steps include:

[0047] 1.1) Design specific primers to mutate the multiple cloning site of the expression vector pTWIN, and mutate the amino acid sequence before the restriction site Not I to oligoglycine;

[0048] 1.2) Design specific primers to introduce the recognition sequence LPXTG of transpeptidase Sortase A into the C-terminus of the protein to be cyclized by PCR amplification;

[0049] 1.3) Select the double restriction sites Not I\Bam H I i...

Embodiment 2

[0060] Thermal Stability Analysis of Circularized Green Fluorescent Protein GFP

[0061] In this example, the activity of transpeptidase Sortase A is utilized to cyclize the green fluorescent protein GFP containing oligoglycine at the N-terminus and the SortaseA recognition sequence LPETG at the C-terminus.

[0062] The first step is to purify the linear GFP containing oligoglycine at the N-terminal and the recognition sequence of transpeptidase Sortase A at the C-terminal. The specific steps include:

[0063] 1.1) Design specific primers to introduce the recognition sequence LPXTG of transpeptidase Sortase A into the C-terminus of the protein to be cyclized by PCR amplification;

[0064] Forward primer: GGGGGGAATTCATGAGTAAAGGAGAAGAACT

[0065] Reverse primer: GGGGGGGATCCTCATCCGGTTTCTGGTAATTTGTATAGTTCATCC

[0066] ATGCC

[0067] 1.2) Select the double restriction sites Not I\Bam H I in the mutant vector pTWIN to construct a protein subclone containing the Sortase A recognit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting a gene polymorphism SNP (single nucleotide polymorphism) site by utilizing cyclization of RNase H (ribonuclease H), which belongs to the technical field of molecular biology. Transpeptidase Sortase A is utilized for cyclization of the linear RNase H, and a probe in the loop-stem structure, a DNA (deoxyribonucleic acid) fragment to be detected, a forward primer and a reverse primer of DNA specificity to be detected, a Vent DNA polymerase and cyclized APERNase H II are further utilized for measuring the specific site SNP of the DNA fragment to be detected, thereby improving the heat stability of the RNase H.

Description

technical field [0001] The invention relates to a method in the field of molecular biology technology, in particular to a method for detecting gene polymorphism SNP sites by using cyclized RNase H. Background technique [0002] Single nucleotide polymorphism (SNP) refers to the polymorphism of the gene sequence caused by the variation of a single nucleotide in the genome. SNPs are widely distributed in the genome, and recent studies have shown that they occur once every 300 base pairs in the human genome. SNP has important application value in the discovery of high-risk groups, the identification of disease-related genes, the design and testing of drugs, and the basic research of biology. Currently, various SNP detection techniques have been developed. However, the existing SNP detection technology is either cumbersome to operate [BioTechniques, 2009, 46: 201-208], or has poor sensitivity [BMC Genomics 2010, 11: 641], or requires expensive detection equipment [Nucleic Acid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/44
Inventor张琳候敬丽
OwnerSHANGHAI JIAO TONG UNIV