Application of tetragenococcus halophilus in removing aflatoxin B1 from high-salt environment
A technology for Tetracoccus halophilus and aflatoxin, which is applied in the field of microorganisms and can solve the problems that the removal effect of baker's yeast and Saccharomyces cerevisiae is not obvious.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0014] Example 1 Removal of AFB in high-salt liquid material system 1
[0015] Add AFB to MRS liquid medium containing 6% to 8% NaCl 1 , so that its concentration reached 10ng / ml, and the halophilic Tetradococcus ( T. halophilus ) suspension, initial cell concentration 5.0×10 6 cfu / ml, the uninoculated sample was used as a control, placed in an incubator at 30±2°C for 72 hours, and sampled for analysis, the halophilic tetrad of the present invention removed 58.05% of the AFB in the sample 1 .
Embodiment 2
[0016] Example 2 Removal of AFB in high-salt semi-solid material system 1
[0017] aflatoxin-producing strains As 3. 4408 (ordered by the Institute of General Microbiology, Chinese Academy of Sciences) is the starting strain, and the broad bean paste is used as the raw material to produce the valve song. The bean paste production process is used to add brine to make the salt content 13.5% and the moisture content 55.0%. will pre-populate into the early logarithmic tetrad of halophilus ( T. halophihus ) suspension into the flap fermented grains, the initial cell concentration was 5.0×10 6 cfu / g(ml), placed in an incubator at 30±2°C for 30 days, aflatoxin B in the fermented grains 1 The removal rate was 35.70%.
Embodiment 3
[0018] Example 3 Using this method to remove AFB in contaminated samples 1
[0019] Contaminated AFB with a certain amount of 1 Doubanjiang was the research object. Pre-propagated to early logarithmic tetrad of halophilus ( T. halophihus ) suspension into contaminated bean paste, the initial cell concentration was 5.0×10 6 cfu / g(ml), simulated factory production environment, cultivated at 25℃~35℃ for 30d, AFB 1 The removal rate reached 41.76%.
[0020] After 16SrDNA molecular biology identification, its 16SrDNA sequence:
[0021]ACGCTGGCGGCGTGCCTAATACATGCAAGTCGAACGCTGCTTAAGAAGAAACTTCGGTTTTTTCTTAAGCGGAGTGGCGGACGGGTGAGTAACACGTGGGGAACCTATCCATCAGCGGGGGATAACACTTGGAAACAGGTGCTAATACCGCATATGGCTTTTTTTCACCTGAAAGAAAGCTCAAAGGCGCTTTACAGCGTCACTGATGGCTGGTCCCGCGGTGCATTAGCCAGTTGGTGAGGTAACGGCTCACCAAAGCAACGATGCATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGCAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTCAGCAAAGAACAGGAGAAAGAGGAAA...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap