Application of tetragenococcus halophilus in removing aflatoxin B1 from high-salt environment

A technology for Tetracoccus halophilus and aflatoxin, which is applied in the field of microorganisms and can solve the problems that the removal effect of baker's yeast and Saccharomyces cerevisiae is not obvious.

Inactive Publication Date: 2011-11-16
SICHUAN UNIV
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the removal effect of baker's yeast a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] Example 1 Removal of AFB in high-salt liquid material system 1

[0015] Add AFB to MRS liquid medium containing 6% to 8% NaCl 1 , so that its concentration reached 10ng / ml, and the halophilic Tetradococcus ( T. halophilus ) suspension, initial cell concentration 5.0×10 6 cfu / ml, the uninoculated sample was used as a control, placed in an incubator at 30±2°C for 72 hours, and sampled for analysis, the halophilic tetrad of the present invention removed 58.05% of the AFB in the sample 1 .

Embodiment 2

[0016] Example 2 Removal of AFB in high-salt semi-solid material system 1

[0017] aflatoxin-producing strains As 3. 4408 (ordered by the Institute of General Microbiology, Chinese Academy of Sciences) is the starting strain, and the broad bean paste is used as the raw material to produce the valve song. The bean paste production process is used to add brine to make the salt content 13.5% and the moisture content 55.0%. will pre-populate into the early logarithmic tetrad of halophilus ( T. halophihus ) suspension into the flap fermented grains, the initial cell concentration was 5.0×10 6 cfu / g(ml), placed in an incubator at 30±2°C for 30 days, aflatoxin B in the fermented grains 1 The removal rate was 35.70%.

Embodiment 3

[0018] Example 3 Using this method to remove AFB in contaminated samples 1

[0019] Contaminated AFB with a certain amount of 1 Doubanjiang was the research object. Pre-propagated to early logarithmic tetrad of halophilus ( T. halophihus ) suspension into contaminated bean paste, the initial cell concentration was 5.0×10 6 cfu / g(ml), simulated factory production environment, cultivated at 25℃~35℃ for 30d, AFB 1 The removal rate reached 41.76%.

[0020] After 16SrDNA molecular biology identification, its 16SrDNA sequence:

[0021]ACGCTGGCGGCGTGCCTAATACATGCAAGTCGAACGCTGCTTAAGAAGAAACTTCGGTTTTTTCTTAAGCGGAGTGGCGGACGGGTGAGTAACACGTGGGGAACCTATCCATCAGCGGGGGATAACACTTGGAAACAGGTGCTAATACCGCATATGGCTTTTTTTCACCTGAAAGAAAGCTCAAAGGCGCTTTACAGCGTCACTGATGGCTGGTCCCGCGGTGCATTAGCCAGTTGGTGAGGTAACGGCTCACCAAAGCAACGATGCATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCGGCAATGGACGCAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTCAGCAAAGAACAGGAGAAAGAGGAAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a strain of tetragenococcus halophilus which can effectively remove aflatoxin B1 (AFB1) in a high-salt environment. First of all, an activated strain of tetragenococcus halophilus is cultivated in an MRS fluid medium until entering the early logarithmic phase, and then applied respectively to a high-salt liquid material system added with pure AFB1 toxin and a high-salt semisolid material system contaminated by AFB1 so as to remove AFB1; finally, the strain of tetragenococcus halophilus is used in a kind of thick broad-bean sauce contaminated by AFB1. In a simulated factory production environment, the removal rate of AFB1 by the tetragenococcus halophilus of the invention can reach 41.76%. The invention is applicable to the traditional brewage industry, especially in the flavouring industry with high-salt environments, and has good economic benefit and practical application value.

Description

technical field [0001] The invention relates to a strain that removes AFB in a high-salt environment 1 The halophilic Tetradendococcus has been preserved in the General Microorganism Center (CGMCC) of the China Microbiological Culture Collection Management Committee (CGMCC) on April 29, 2010, and the preservation number is CGMCC No.3792, which belongs to the field of microorganisms. Background technique [0002] Aflatoxins are produced by Aspergillus flavus ( Aspergillus flavus ) and Aspergillus parasitica ( Aspergillus parasiticus ) and other secondary metabolites, aflatoxins especially aflatoxin B 1 (AFB 1 ) has a strong carcinogenic effect. Therefore, countries have strict restrictions on the content of raw materials and products such as agricultural products and various foods. [0003] Since the discovery of aflatoxin in 1960, scientists from all over the world have tried to find effective ways to prevent and remove aflatoxin. At present, there are five main method...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A23L1/015A23L1/22C12N1/20C12R1/01A23L5/20A23L27/00
Inventor 黄钧李从虎刘超兰周荣清
Owner SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap