Serine protease inhibitor pp-pi polypeptide from chrysalis chrysalis chrysalis venom and its application

A technology of serine protease, golden bee, applied in the direction of protease inhibitor, application, peptide source, etc.

Active Publication Date: 2011-11-30
ZHEJIANG UNIV
View PDF6 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, with the continuous planting of insect-resistant Bt crops with only a single Bt gene, the problem of target pest resistance to it has attracted increasing attention, and this concern has been reported on the American cotton bollworm H.zea in Bt cotton fields. There are signs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serine protease inhibitor pp-pi polypeptide from chrysalis chrysalis chrysalis venom and its application
  • Serine protease inhibitor pp-pi polypeptide from chrysalis chrysalis chrysalis venom and its application
  • Serine protease inhibitor pp-pi polypeptide from chrysalis chrysalis chrysalis venom and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] 1. Isolation and N-terminal sequencing of chrysalis chrysalis venom protein components:

[0076] The female Pteromalus puparum (Pteromalus puparum) was dissected in PBS (including PMSF) on ice with an Olympus dissecting microscope and a dissecting needle. The venom sac and venom gland were centrifuged at 16000g for 1 min to obtain the supernatant, which was freeze-dried and dissolved in deionized water as a sample for the separation of venom proteins.

[0077] The chromatographic column is an Aligent C18 column (15cm×4.6mm, particle size 5 μm); the mobile phase is trifluoroacetic acid (TFA) (A--1: 1000, namely containing TFA0.1% aqueous solution) and acetonitrile (B), in 40min The internal acetonitrile concentration ranges from 0 to 40% (volume concentration of acetonitrile), the flow rate is 1.0 mL / min, the detection wavelength is 214 nm, and single peaks are collected.

[0078] Entrust the Institute of Biophysics, Chinese Academy of Sciences to complete mass spectrom...

Embodiment 2

[0119] 1. Construction of PpPI gene plant binary expression vector

[0120] Using cauliflower mosaic virus CaMV 35S promoter and NOS terminator on both sides of GUS gene in plant binary expression vector pBI121, insert PpPI gene to form a complete expression framework. In this experiment, BamHI and SacI were selected as restriction sites to replace the GUS gene with PpPI, so that the expression boxes on both sides of the GUS gene were used to control the expression of the PpPI gene in Arabidopsis plants.

[0121] Primers with BamH I and Sac I restriction sites were designed according to the ORF of the serine protease inhibitor of the venom of A. chrysalis, and the plant expression vector was constructed by PCR amplification using the venom cDNA of A. chrysalis as a template. The primer sequences are:

[0122] PpPI-SP: TCG GGATCC ATTCTGTACAAGATGAGGACGAT,

[0123] PpPI-AP: CGC CTAAGAGCAATTCATTCGTGTG,

[0124] in, GGATCC is the BamH I restriction site, Sac I restrictio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Pteromalus puparum venom serine protease inhibitor Pp-PI polypeptide which has an amino acid sequence shown in SEQ ID NO: 2. At the same time, the invention also discloses a gene for encoding the Pteromalus puparum venom serine protease inhibitor Pp-PI polypeptide. The gene has a nucleotide sequence from the 126th nucleotide to the 290th nucleotide in SEQ ID NO: 1; or the gene has at least 70% homology with the nucleotide sequence from the 126th nucleotide to the 290th nucleotide in SEQ ID NO: 1; or the gene has a nucleotide sequence which can hybridize with the nucleotide sequence from the 126th nucleotide to the 290th nucleotide in SEQ ID NO: 1 at 40-55 DEG C. The Pteromalus puparum venom serine protease inhibitor Pp-PI polypeptide can be used to prepare a Pteromalus puparum venom serine protease inhibitor for genetically modifying crops or altering plant symbiotic bacteria.

Description

technical field [0001] The invention relates to the fields of molecular biology, genetic engineering and protein engineering. In particular, a serine protease inhibitor protein expressed in the chrysalis chrysalis venom and its encoded nucleic acid sequence and application. Background technique [0002] Pests have always been a serious threat to the safe production of global crops, causing about a quarter of global food production to be reduced every year, resulting in huge economic losses. In my country, agricultural pests are also an important factor restricting the increase of agricultural production and the improvement of the quality of agricultural products. According to statistics, the annual area of ​​pests and diseases in the country has increased from 5 billion mu per time in 2000 to 7 billion mu per time in 2009. The annual grain loss restored through the prevention and control of diseases and insect pests accounts for about 15%-20% of the total output. Even so, t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/81C12N15/15A01P7/04C12N15/84A01H5/00C12N15/09C12R1/19
CPCY02P20/582
Inventor叶恭银王磊方琦王飞朱洋铿
OwnerZHEJIANG UNIV