Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multifunctional slow virus carrier capable of restraining endogenesis target genes and simultaneously expressing exogenous genes

A lentiviral vector and exogenous gene technology, applied in genetic engineering, plant genetic improvement, biochemical equipment and methods, etc., can solve problems such as off-target effects and siRNA difficulties, and achieve the effect of improving curative effect and eliminating negative effects.

Inactive Publication Date: 2012-02-08
聂凌云
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although there are many principles and algorithms for designing siRNA, it is still difficult to design very specific siRNA
A large body of evidence shows that the most common problem with siRNA-mediated gene silencing is off-target effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multifunctional slow virus carrier capable of restraining endogenesis target genes and simultaneously expressing exogenous genes
  • Multifunctional slow virus carrier capable of restraining endogenesis target genes and simultaneously expressing exogenous genes
  • Multifunctional slow virus carrier capable of restraining endogenesis target genes and simultaneously expressing exogenous genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: Construction of α-ACTN1 shRNA expression cassette:

[0045] The predicted human α-ACTN1 shRNA target sequence is 5’GGGACACAGATCGAGAACATCGAAGAG( Figure 7 ). Design a pair of complementary oligonucleotides with the following sequences:

[0046] A1:

[0047] 5’-CTAGAGGGACACAGATCGAGAACATCGAAGAGTTCAAGAGACTCTTCGA TGTTCTCGATCTGTGTCCCTTTTTC

[0048] A2:

[0049] 5'TCGAGAAAAAGGGACACAGATCGAGAACATCGAAGAGTCTCTTGAACTCTTCGATGTTCTCGATCTGTGTCCCT

[0050] Mix the pair of primers A1 / A2 in equal amounts, denature at 95°C for 5 minutes, and cool and anneal naturally. Ligated with the lentiviral vector PU2-FH digested with XbaI / XhoI to obtain the plasmid PU2-α-ACTN1shRNA.

Embodiment 2

[0051] Embodiment 2: Construction of anti-RNAi human α-ACTN1 (rr-α-ACTN1) cDNA ( Figure 7 )

[0052] According to the siRNA target sequence, without affecting the amino acid sequence, design primers containing 4 point mutations, the sequence is as follows:

[0053] (1); 5'-AGAGAATTCCATGGACCATTATGATTCTCAGCAAAC,

[0054] (2); 5'-CCTCTTCAATATTTTCAATCTGTGTCCCCGCCTTCCGGAG,

[0055] (3); 5'-CACAGATTGAAAATATTGAAGAGGACTTCCGGGATGGCCTG,

[0056] (4); 5'-CTCGGTACCGGTGAGGTCACTCTCGCCGTACAG,

[0057] Using the plasmid GC-Z6382 (purchased from genecopoeia) as a template, the N-terminal fragment (N-ter) of rr-α-ACTN1 was amplified with 1 and 2 primers, and the C-terminal fragment (C-ter) was amplified with 3 and 4 primers Amplify, and then use ligation PCR to use 1, 4 as primers, and two purified mixed PCR product fragments as templates to amplify the full-length rr-α-ACTN1, which is digested with EcoRI / AgeI and cloned into the same EcoRI / AgeI In the lentiviral plasmid PU2-α-ACTN1 shRNA...

Embodiment 3

[0061] Example 3: Production and introduction of lentivirus

[0062] 293T cells (purchased from ATCC) were cultured in a petri dish with a diameter of 10 cm, and the packaging plasmid pHR'8.2deltaR / pCMV-VSV-G (purchased from addgene) was used in a ratio of 8:1 (the total DNA amount was 5 μg) respectively. Co-transfect with two lentiviral recombinant plasmids: PU2-α-ACTN1 shRNA, PU2-α-ACTN1 shRNA+rr-α-ACTN1+GFP (5 μg each), replace the culture medium after 24 hours, and start from transfection the next day The virus-containing culture fluid was collected from the 293T cells and filtered through a 0.45 μm filter to remove residual 293T cells. When infecting Jurkat T cells (purchased from ATCC), mix the virus with an equal volume of fresh medium, add protamine sulfate (final concentration of 10 μg / ml, Sigma), and culture the cells for 6 hours or overnight, then replace with fresh medium without After 24 hours, puromycin was added to the virus culture solution for selection until...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multifunctional slow virus carrier capable of restraining endogenesis target genes and simultaneously expressing exogenous genes. The carrier is formed by a genetic engineering technology, is composed by two promoters and two corresponding multi-cloning sites for inserting shRNA and genes, can utilize an RNA interference technology to restrain the cell endogenesis genes, and simultaneously can recover the expression of the cell endogenesis genes through importing the exogenous genes, and accordingly, the normal phenotype of the whole cell is recovered. The technology overcomes a plurality of difficult points of the RNA technology, such as the RNA interference specificity and efficient infection cells are ensured, and stable expression can be realized in the cells. Consequently, base researchers can more accurately express the status of the target genes in a signal path and a plurality of unknown functions, the carrier also can be used for restraining the target gene with defect endogenesis functions, so efficient importing is realized, the wild type target genes with the endogenesis functions are stably expressed, and a very powerful tool is provided for gene treatment.

Description

technical field [0001] The present invention relates to genetic engineering technology, in particular to a method capable of stably expressing shRNA to suppress endogenous function-deficient or wild-type target genes of cells, while at the same time stably expressing imported functional wild-type or mutant exogenous genes to replace endogenous genes. The source gene can cause corresponding changes in cell traits to confirm the construction of a multifunctional lentiviral vector for the function of the gene. Background technique [0002] After the completion of the human genome sequencing project, the development of tools to study genome function has posed new challenges. Small interfering RNA (siRNA) has been proven to be a rapid and powerful technique for studying gene function. However, since siRNA is continuously degraded and reduced with cell division after electroporation or liposome transfection into cells, it is difficult to maintain stable inhibition of target genes....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867
Inventor 聂凌云冯云峰池振奋彭钊杨琼杨宽赵永良聂凌虎
Owner 聂凌云
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com