Bacillus licheniformis and applications thereof

A technology of Bacillus licheniformis and strains, applied in the directions of bacteria, microorganisms, biochemical equipment and methods, etc., can solve the problems of low production efficiency, long cycle of 72 hours, long production cycle of Bacillus licheniformis, etc., and achieves high production efficiency and fermentation. short cycle effect

Inactive Publication Date: 2012-03-07
INST OF PROCESS ENG CHINESE ACAD OF SCI
View PDF7 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Many researchers have used genetic engineering, medium optimization, and culture condition control to increase the yield, but using B.licheniformis ATCC 9945A, the yield is generally around 17-45g / L, and the fermentation time is generally 96h Relatively long, and a high concentration of glycerin needs to be added in the process, so its production cost is high
The yield of B. licheniformis SAB-26 is higher (Abdel-Fattah, Y.R., N.A.Soliman, and M.M.Berekaa, Application of Box-Behnken Design for Optimization of Poly-γ-Glutamic Acid Production by Bacillus licheniformis SAB-26. Research journal of microbiology, 2007, 2 (9): 664-670), can reach the yield of 59.9g / L, but the period is 72h is also long, and the molecular weight of γ-PGA produced by B.licheniformis SAB-26 is only 70kDa-180kDa, not Capable of meeting high molecular weight requirements
In summary, the production cycle of Bacillus licheniformis is long, the production efficiency is low, and the cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus licheniformis and applications thereof
  • Bacillus licheniformis and applications thereof
  • Bacillus licheniformis and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: Isolation and screening of bacterial strains of the present invention

[0036] Select a variety of soybean sauces produced in China, take 1g each into a sterilized test tube, add 9mL of sterile water, seal with a cotton plug, shake for 2min, then put it in a water bath, heat at 70°C for 10min, and then let it stand for 30min. After cooling, absorb 0.1 mL of the supernatant and dilute 10 2 and 10 3 times, respectively take 0.2mL, spread LB plate (sodium glutamate 10g / L, peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, agar powder 15g / L, pH7.2), 37 Cultivate at ℃ for 48 hours to observe the results, select a single colony that is emulsion-like and capable of drawing on LB medium, and insert it into fresh LB liquid seed medium (peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, pH7. 2), after 12 hours of culture on a shaker at 37°C, inoculate 2% of the inoculum into 250mL shake flasks (sodium glutamate 50g / L, glucose 50g / L, citric acid Sodium...

Embodiment 2

[0037] Embodiment 2: the identification of bacterial strain of the present invention

[0038] Physiological and biochemical identification

[0039] The Bacillus licheniformis bacterial strain provided by the invention is straight rod-shaped and Gram-staining positive. On LB solid medium, the colonies are round, dry, opaque, spreading, ragged, and hairy. The optimum growth temperature is 30-37℃, and the suitable pH is 6.8-7.2. The contact enzyme test was positive, the nitrate test was positive, the citrate test was positive, and the gelatin liquefaction test was positive.

[0040] Identification of Bacterial Species Using 16S rRNA Gene Sequence Analysis

[0041] The total DNA of strain P-104 was extracted by a bacterial genome extraction kit, and the 16S rRNA gene PCR amplification was carried out with universal primers (27f: AGAGTTTGATCCTGGCTCAG) and (1492r: GGTTACCTTGTTACGACTT). The PCR program was: 94°C pre-denaturation for 5 min; 94°C denaturation for 45 s, 55°C anneali...

Embodiment 3

[0042] Embodiment 3: Qualitative and quantitative analysis of polymer products produced by bacterial strain P-104 of the present invention

[0043] Using ultraviolet spectrum scanning and infrared spectrum analysis, and comparing with the spectrogram of γ-PGA standard product, it shows that the high molecular product obtained by strain P-104 fermentation is γ-PGA.

[0044] The polymer product produced by bacterial strain P-104 of the present invention is hydrolyzed under acidic conditions, and the hydrolyzed product is subjected to qualitative and quantitative analysis by HPLC. The chromatographic column used is Brava C18-BDS, and the mobile phase is 10mmol / LKH 2 PO 4 Add 5.0% methanol (adjust the pH value to 2.5 with phosphoric acid, filter, and degas by ultrasonic), the flow rate is 1mL / min, the ultraviolet detection wavelength is 210nm, and the glutamic acid standard is used as a qualitative and quantitative standard. γ-PGA concentration = glutamic acid concentration after...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to Bacillus licheniformis P-104 for gamma-PGA (gamma-polyglutamic acid) fermentation production and applications thereof. The Bacillus licheniformis P-104 is conserved in China General Microbiological Culture Collection Center (CGMCC) on September 14, 2010 with the conservation number of CGMCC NO.4156. The Bacillus licheniformis P-104 is obtained by screening and separating the Chinese traditional fermented bean paste product, and has the advantages of short production period, high production efficiency and low production cost. By using the strain and fermentation method thereof provided by the invention, the output of a 7 L fermentation tank of gamma-PGA can reach 32 g / L, and the fed-batch fermentation yield reaches 41.6 g / L.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to high-yield gamma-PGA strains and applications thereof, namely bacillus licheniformis (Bacillus licheniformis) P-104 and a method for fermenting and producing gamma-PGA. Background technique [0002] γ-polyglutamic acid (γ-PGA) is a monomer formed from L-glutamic acid and D-glutamic acid, which is formed by condensation of α-amino and γ-carboxyl groups in the form of peptide bonds. Made of the same polyamide. γ-PGA is mostly produced by microbial fermentation, and its molecular weight is usually 100-1000kDa (Buescher, J.M. and A.Margaritis. Microbial biosynthesis of polyglutamic acid biopolymer and applications in the biopharmaceutical, biomedical and food industries. Critical Reviews in Biotechnology, 2007, 27: 1-19), γ-PGA with different molecular weights have different uses. γ-PGA not only has good biocompatibility and biodegradability, but also has functional properties such as th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12P13/02C12R1/10
Inventor刘会洲罗明芳张业伟魏雪团
OwnerINST OF PROCESS ENG CHINESE ACAD OF SCI