Genetic engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of genetic engineering bacteria

A genetically engineered bacteria, a technology for producing succinic acid, which is applied in the field of bioengineering and can solve problems such as polluting the environment and wasting resources

Inactive Publication Date: 2013-12-04
NANJING TECH UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, except for the use in the paper industry, most of them are discarded, which seriously wastes resources and pollutes the environment.
Its main components are cellulose, hemicellulose and lignin, so its hydrolyzate is a good sustainable green carbon source for microbial fermentation, but its hydrolyzate contains high concentration of xylose, so it is now In the prior art, most succinate-producing Escherichia coli cannot use rice straw hydrolyzate to ferment and produce succinic acid. Tao Wenyi et al. treated rice straw with dilute sulfuric acid at 121°C for 1 hour, and then treated the straw with 20 g / L NaOH at 121°C 1h, the total mass concentration of both glucose and xylose reached about 50 g / L
[0007] Bagasse is the main component left after sugar cane sugar is squeezed, so its hydrolyzate is a good sustainable green carbon source for microbial fermentation, but its hydrolyzate contains high concentration of xylose, Therefore, most succinate-producing Escherichia coli in the prior art cannot use rice straw hydrolyzate to ferment and produce succinic acid, and the cellulose containing about 50% can be pretreated by crushing and alkali / oxidation method to obtain a total sugar mass of 50 g / L, of which xylose accounts for more than 80%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of genetic engineering bacteria
  • Genetic engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of genetic engineering bacteria
  • Genetic engineering bacterium for producing succinic acid and method for producing succinic acid by fermentation of genetic engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] This example illustrates the use of homologous recombination technology to knock out phosphoenolpyruvate carboxylase in the starting strain NZN111 ppc gene, resulting in the elimination of apramycin-resistant strains.

[0042] 1. Using LB medium, cultivate Escherichia coli NZN111 to OD at 37°C under aerobic conditions 600 =0.4~0.6, prepared to be electrotransfer competent.

[0043] 2. Electrotransform plasmid pKD46 into competent Escherichia coli NZN111. The electric shock conditions were: 200 Ω, 25 μF, electric shock voltage 2.3 kV, electric shock time 4-5 ms. Immediately after the electric shock, the cells were added to pre-cooled 1 mL SOC medium, cultured at 150 r / min, 30°C for 1 h, and then spread on the LB medium plate with ampicillin (amp) to screen the positive transformant Escherichia coli NZN111 ( pKD46).

[0044] 3. Add 10 mM L-arabinose to LB medium, induce plasmid pKD46 to express λ recombinase at 30°C, and make electroporation competent.

[0045] 4. U...

Embodiment 2

[0056] This example illustrates the method of constructing an expression plasmid that overexpresses phosphoenolpyruvate carboxykinase, can efficiently utilize xylose for fermentation, and accumulate a large amount of succinic acid to obtain the strain Escherichia coli BA204.

[0057] 1. Construction of an expression plasmid for overexpressing phosphoenolpyruvate carboxykinase, the process comprising:

[0058] (1) synthetic with Sac I and Xba Primers for I restriction sites,

[0059] Upstream primer: 5'- CGAGCTCATGAACTCAGTTGATTTGACCG -3';

[0060] Downstream primer: 5'-GCTCTAGAGCATTCCGTCAATTAAAACAAG -3'.

[0061] (2) with Bacillus subtilis The genome was used as a template, and the target gene fragment was amplified by PCR. The reaction conditions were: 94°C for 5 min; (94°C for 45 s, 53°C for 45 s, 72°C for 100 s, 35 cycles); 72°C for 10 min. purified amplified pck After the gene, the expression plasmid was used respectively with pTrc99a Sac I and Xba I double d...

Embodiment 3

[0064] This example illustrates the comparison between Escherichia coli BA204 and the starting strain to produce acid by fermentation.

[0065] Escherichia coli BA204 can efficiently utilize xylose for fermentation, and accumulate succinic acid in large quantities. It adopts a two-stage fermentation method. Aerobic culture bacteria OD 600 Induce to OD at about 0.4-0.6 with 0.3 mM IPTG 600 =3, transfer to serum bottle for anaerobic fermentation according to 10% inoculum size, and ferment for 48 h.

[0066] The aerobic phase medium is: LB+Amp (ampicillin 50 μg / mL).

[0067] The medium in the anaerobic stage was: LB+xylose (20 g / L)+basic magnesium carbonate 0.48 g+Amp (ampicillin 50 μg / mL)+0.3 mM IPTG.

[0068] The fermentation results are shown in Table 1.

[0069] Table 1 Escherichia coli Comparison of BA204 and starting strains for acid production

[0070]

[0071] Note: ND means not detected.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering, and relates to a genetic engineering bacterium for producing succinic acid and a method for producing the succinic acid by fermentation, in particular to a recombinant strain which is grown by utilizing xylose efficiently and is used for producing the succinic acid and a method for producing the succinic acid by utilizing the fermentation of the strain. The genetic engineering strain for producing the succinic acid belongs to the class of Escherichia coli BA204, and the conservation register number is CCTCC No:M2011207. A construction process comprises the steps of: inactivating or removing phosphoenolpyruvate carboxylase, and over-expressing phosphoenolpyruvate carboxylation kinase, so that the recombinant Escherichia coli can be grown by utilizing xylose metabolism to improve the synthetic efficiency of the succinic acid is improved substantially. In the fermentation method, a two-stage fermentation mode is adopted, wherein in an aerobic stage, biomass is improved; and in an anaerobic stage, acid is produced by the fermentation.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a succinic acid-producing genetically engineered bacterium and a method for fermenting and producing succinic acid, in particular to a recombined bacterial strain that efficiently utilizes xylose to grow and produce succinic acid, and uses the bacterial strain to ferment Process for producing succinic acid. Background technique [0002] Succinic acid, also known as succinic acid, is widely used in industries such as medicine, pesticides, dyes, spices, paints, food and plastics. As a C4 platform compound, it can be used to synthesize 1,4-butanediol, tetrahydrofuran, Organic chemicals such as γ-butyrolactone and biodegradable materials such as polybutylene succinate (PBS) are considered by the US Department of Energy to be among the 12 most valuable biorefinery products in the future. [0003] The production methods of succinic acid mainly include chemical synthesis and micro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12R1/19
Inventor姜岷刘嵘明梁丽亚马江锋陈可泉韦萍
OwnerNANJING TECH UNIV