Long non-coding RNA and application thereof

A molecular and oligomeric nucleic acid technology, applied in the field of biomedicine, which can solve the problems of IncRNA in its infancy.

Inactive Publication Date: 2012-05-02
PEKING UNIV
View PDF1 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, most of the research in the field of ncRNA is small molecule ncRNA, while the research on IncRNA is still in its infancy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long non-coding RNA and application thereof
  • Long non-coding RNA and application thereof
  • Long non-coding RNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] Example 1. Acquisition and identification of full-length cDNA of long non-coding RNA Yiya

[0096] 1. Nucleic acid sequence (SEQ ID No1) of Yiya gene:

[0097] 5’-TTTGGGATGGAGGAAGTGAGGGAGAAGTGCTTCAGAGGTGGCAGCAATGTGCTTCTGAGCGTGGCTGCGTGGCTCCCTATTTCAATCTGCCTGTGAAGATTTCCTGAGGCATATGACCCTTCCTGCCATGACCCTTGGTTTCCAGAGGCATCTGCTGGTCAGCCCCTAGGCAACACTTAAATAGGAAAACTTTTGCCTATCTGTTACTAAGACATGCTGATTTCCAGATATCTTAGTACCCTTTTTATTATCTCTCTGCCTGGGGTTTAATAACAGTTAAAAGAGACAATTCATGCAATGTGCAACAAAGTTTACTTTGTGTACATATATTTGCTCTGCACATAGCTGGCATATAGTAACTGCTCAATAAATATCAGTGGCTATTATAATCTAGAGCTTGTTGGGGAGTTGTCTGAGTGAGAAAAGAACAAAAGATACTCGTTTTACAAACAATTTTTGCTTCATCTCTGGATGGCATATTCATTTCTGAAGCATCTTCACACTCAGTTGCTAAGAATAGGATATATTCTTTCCATTGTACAGATGGAGTAACCGAGAGACTGGAAAGTGACATCACCAACAGGCGGTGACCTAGGGAGTCAGGGCCAGAACCAGGTCTGGAATACAGACTTCCTGACTCCTGACCCAGGTTCCCTTCTGCCCTGTGGCCTTCACAGGACGCCTGGAGAGACCAGGGAAGTATCTGTTTCAGGGCTCTCTGAGTTGCCCTTGGAAGTTTATCATCTATCAACTGACTGTTGACCAAAAACACACTGATTCCTGAGGAGACCTTACAGGATGTCCTGTTGAGACTTTTCCTCCT...

Embodiment 2

[0106] Example 2. Northern hybridization detection of Yiya expression difference in tumor and normal tissues

[0107] 1. Yiya hybridization probe sequence (SEQ ID No 6)

[0108] 5’-ATCACTTCTCATCTAGATTCCCATTTTGGCTTTGTCATCTTCTCCCACTACATTCCAGCTATGTAGTCCTTCATATAGTTTCTAGAACGTGCCAAGATTTCTCTTCTAGATCTTTGCATTTGAAATTCCCTTTGCTTATAATGCTCTTGCCTAGCTCTTCATATATCTGGCTTGAGGGCATCTCTTAAGAGAGGACTTCGACTTCACCAATCTGAAACAGCACCATGTCAC

[0109]2. Northern hybridization to detect the expression of Yiya in tumor samples

[0110] 1) Extraction of total RNA from tissue samples: Weigh 1 gram each of 8 pairs of human tumor tissues and adjacent normal tissue samples (including liver cancer, esophageal cancer, ovarian cancer, and breast cancer) separated by surgery, and use NORGEN’s animal tissue RNA purification reagent The total RNA was extracted by the box; 20 μg of total RNA was denatured with formaldehyde, loaded onto 1% formaldehyde-denatured agarose gel, and electrophoresed under the conditions of 100V ...

Embodiment 3

[0116] Example 3. Subcellular localization of Yiya transcripts

[0117] Make the 5×10 a day in advance 5 HEK293 cells were planted in a cell culture dish with a diameter of 10 cm at an appropriate density. When the cells grew to about 75% of the density, the cells were collected; the medium was exhausted and washed twice with 2 ml of pre-cooled PBS; 5ml of pre-cooled PBS, scrape the cells with a cell knife, and inhale into a 15ml centrifuge tube; centrifuge at 1850g for 10 minutes at 4°C, discard the supernatant; add 5 times the volume of the cell sedimentation hypotonic buffer to resuspend, and wash the cells; 4 Centrifuge at 1850g for 5 minutes at ℃, discard the supernatant; resuspend the cells in hypotonic buffer twice the volume of the cell pellet, and let stand on ice for 10 minutes; slowly homogenize 30-40 times with a Dounce homogenizer; 4℃, 3300g Centrifuge for 15 minutes, discard the supernatant, and the collected pellet is the nucleus. (Freshly prepared hypotonic b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a long non-coding RNA and an application thereof. The long non-coding RNA has a sequence represented by SEQ ID No.1. The invention also provides a purpose of the long non-coding RNA as a tumor marker, and probes and primers used for detecting the long non-coding RNA. The invention also provides an inhibitor of the long non-coding RNA. The inhibitor assists in inhibiting the expression of the long non-coding RNA and tumor cell proliferation. The invention further provides a medicine composition comprising the inhibitor.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a new tumor marker and its use. Background technique [0002] There are about 20,000 to 30,000 genes that encode proteins in the human body, accounting for only 2% of the human genome, and the remaining 98% of genomic DNA that does not encode proteins was originally considered to be nonfunctional and garbage in organisms, often called "Junk DNA. However, current research shows that most of these junk DNA can be transcribed to produce non-coding RNA (non-coding RNA, ncRNA). According to the size of mature transcripts, ncRNA can be divided into small molecule ncRNA (such as siRNA, miRNA, piRNA, etc.), medium-length ncRNA (70-200nt) and long ncRNA (long ncRNA, IncRNA, >200nt). At present, the research in the field of ncRNA is mostly small molecule ncRNA, and the research on IncRNA is still in its infancy. Due to the sequence There are too many stop codons inside, IncRNA ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor杜权丁先锋梁子才
OwnerPEKING UNIV