High affinity fusarium specific single-chain antibody and preparation method thereof
A single-chain antibody, affinity technology, applied in the field of genetic engineering, can solve the problems of undiscovered wheat varieties, limiting the progress of wheat scab resistant breeding, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1: A method for preparing a high-affinity Fusarium-specific single-chain antibody, the steps of which are:
[0044] A. Using Error-prone PCR and DNA shuffling technology to transform antibody genes:
[0045] 1) Using the F. graminearum antibody gene CWP2 as a template (Accession number: AJ517190), use the forward primer pIIIF (ACGTACCATGGCTGCCGTGACGT) and the reverse primer pIIIR (AGTCAGTCGACGGGCTGGCCTAG) for Error-prone PCR amplification. In 50μl PCR reaction solution, containing 5μl PCR buffer (10mM Tris-HCl (pH 8.3), 50mM KCl, 7.5mMMgCl2, 0.5mM MnCl 2 ,), 0.2mM dNTPs, 0.8mM dCTP and dTTP, 0.3μM forward and reverse primers, 5U Taq polymerase. Error-prone PCR reaction conditions were: 95°C for 5min; 94°C for 1min, 55°C for 1min, 72°C for 1min, 30 cycles; finally 72°C for 10min.
[0046] 2) Error-prone PCR products were recovered with a DNA gel purification kit (purchased from QIAGEN, operated according to the instructions of the kit).
[0047] 3) The purifie...
Embodiment 2
[0178] Example 2: The application of a high-affinity Fusarium-specific single-chain antibody in cultivating wheat scab-resistant varieties, the steps are:
[0179] 1) Add the cell wall protein of Fusarium asiaticum (Fusarium asiaticum) from wheat, the cell wall protein of F. oxysporum f.sp. matthiolae from violet, and the protein of F. F.oxysporum f.sp.zingiberi cell wall protein, F.oxysporum f.sp.niveum cell wall protein from watermelon, yellow sickle from wheat F. culmorum, F. solani from cucumber, F. tricinctum from wheat, S. sclerotiorum from rapeseed, Peach brown rot from peach Bacteria (M. fructicola) and control liquid GYT medium each 100 μl, 37 ℃ water bath coating 2h.
[0180] 2) Wash 3 times with 300 μl PBS.
[0181] 3) Add 300 μl of blocking solution (PBS solution containing 2% (W / V) skimmed milk powder) to the antigen-coated wells and control wells (blank wells), and block in a water bath at 37° C. for 2 hours.
[0182] 4) Wash 3 times with 300 μl PBS, 1 min eac...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More