Swine pseudo attp site and use of swine pseudo attp site
A promoter and optional technology, applied in the field of bioengineering, can solve problems such as unfavorable cultivation of stable strains, inactivation, destruction of endogenous genes, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Embodiment 1, the construction of the pCMV-Int vector containing streptomyces phage ΦC31 integrase gene
[0064] (1) Synthesis of Streptomyces phage φC31 integrase gene (Int gene): Submit the sequence shown in SEQ ID NO: 5 to Shanghai Jierui Biotechnology Co., Ltd. for Int gene synthesis, and construct the synthesized Int gene in pGH vector On, get the pGH-Int plasmid.
[0065] (2) Enzyme digestion of pGH-Int plasmid: Take 20 microliters (400-500ng / ul) of pGH-Int plasmid for enzyme digestion. The enzyme digestion system is:
[0066] pGH-Int plasmid
20 microliters
10xNEB buffer2
5 microliters
endonuclease NheI
1 microliter
1 microliter
[0067] 100xBSA
0.5 μl
double distilled water
22.5 µl
total reaction volume
50 µl.
[0068] Place the above enzyme digestion system at 37°C and digest overnight.
[0069] (3) Enzyme digestion of pcDNA3.1 plasmid: take 10 mic...
Embodiment 2
[0076] Embodiment 2, the construction of pattB-CAG-Intron-EGFP carrier
[0077](1) Synthesis of attB and Intron gene fragments: Submit the sequence Intron (intron) sequence and the attB sequence shown in SEQ ID NO: 4 to Shanghai Jierui Biotechnology Co., Ltd. for gene synthesis, and construct the synthesized genes separately On the pGH vector, pGH-attB and pGH-Intron plasmids were obtained, respectively. Among them, the NCBI of the used intron is AF369966.1, and the full length of the sequence is
[0078] CGAATCCCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGC...
Embodiment 3
[0084] Embodiment 3, cell transfection and screening
[0085] The porcine kidney epithelial cell line PK15 was inoculated into a 6-well plate at a density of 30%, and the cells were cultured until the confluence was 70-80%, and transfection was started.
[0086] (1) Transfection: The pCMV-Int plasmid obtained in Example 1 and the pattB-CAG-Intron-EGFP plasmid obtained in Example 2 were mixed in different ratios, and the liposome LF2000 kit was used to follow the manufacturer's instructions. Instructions for transfecting PK15 cells.
[0087] (2) Exploration of the effect of two plasmid ratios: with the quality of the pattB-CAG-Intron-EGFP plasmid constant at 1 microgram, by selecting the quality of the pCMV-Int plasmid as 1 microgram, 2 micrograms, 3 micrograms, 4 micrograms, and 5 micrograms, The pattB-CAG-Intron-EGFP: pCMV-Int was transfected into PK15 cells according to different ratios of 1:1, 1:2, 1:3, 1:4, and 1:5. The best mixing ratio, the result is that the fluoresce...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
