Key gene PeWOX11b for adventitious root development of poplar and application of key gene PeWOX11b
A key gene and root development technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of no WOX gene family and unclear regulatory network
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0036] Example 2 Cloning of the PeWOX11a gene by RACE technology
[0037] Using the 895 poplar cDNA prepared in Example 1 as a template, use specific primers to amplify the short fragment of the PeWOX11b gene, wherein the forward primer for amplifying the short fragment of PeWOX11b is: 5'AACGCCAGATGCAAGCTAGT 3 The reverse primer for amplifying the PeWOX11b short fragment is: 5’TCTGTTGGAACCCCATTGAT 3 The high-fidelity PCR reaction system is as follows: 10×LA PCR Buffer (Mg 2+ free) 5.0μL; 2.5mM dNTP Mixture 8.0μL; 25mM Mg 2+ 5.0 μL; LA Taq DNA Polymerase (5U / μL) 0.5 μL; forward primer (10 μM) 2 μL; reverse primer (10 μM) 2 μL; template (895 poplar cDNA) 1 μL; add sterile ddH 2 O to make up 50 μL. Reaction program: pre-denaturation at 94°C, 3min; 94°C, 40s, 55°C, 30s, 72°C, 30s, 35 cycles; 72°C, 10min. The product was sequenced, and the obtained PeWOX11a gene short fragment sequence is shown in SEQ NO3.
[0038] According to the short fragment sequence of PeWOX11a gene ...
Embodiment 3
[0078] The genetic transformation of embodiment 3PeWOX11b gene
[0079] The constructed pH35GS-PeWOX11b overexpression vector was transformed into Agrobacterium strain EHA105 (Invitrogen) by liquid nitrogen freeze-thaw method, and PeWOX11b gene was transferred into poplar through Agrobacterium-mediated. The result is as Figure 2-7 As shown, among them, figure 2 Semi-quantitative detection for transgenic poplar overexpressing PeWOX11b gene; image 3 It is a comparison of the overall morphology of the transgenic poplar overexpressing the PeWOX11b gene and the non-transgenic poplar. In the figure, the non-transgenic poplar is on the left, and the transgenic poplar is on the right; Figure 4 Comparison of root morphology between transgenic poplar overexpressing PeWOX11b gene and non-transgenic poplar. In the figure, non-transgenic poplar is on the left, and transgenic poplar is on the right; Figure 5 Transgenic poplar overexpressing PeWOX11b gene was subcultured for 10 weeks...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap