miRNA molecule and application thereof

A molecular and nucleotide technology, applied in the field of miRNA molecules, can solve problems such as lost treatment time

Inactive Publication Date: 2012-07-25
GUANGZHOU RIBOBIO
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Early detection and early treatment are the most effective ways to reduce cancer mortality. The implementation of a screening system for colon cancer, cervical cancer, and breast cancer can reduce the number of cancer deaths worldwide by one-third. Currently, in developing countries, 80 % of cancer patients are discovered at the advanced stage of the disease, losing the best treatment time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • miRNA molecule and application thereof
  • miRNA molecule and application thereof
  • miRNA molecule and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1. Low expression of miR-139-5p in lung cancer tissues and cells

[0051] The primers for quantitative detection of miR-139-5p used in this example were from Guangzhou Ruibo Biotechnology Co., Ltd. The human lung adenocarcinoma cell line A549 is from ATCC, routinely cultured in 1640 culture medium containing 10% fetal bovine serum, and placed in an incubator with 5% CO2 and 37°C saturated humidity for passage. The tissue samples were obtained from the First Affiliated Hospital of Guangzhou Medical College. The informed consent of the patients was obtained before sampling. The use of the samples complied with the relevant medical ethics. The pathological tissue samples from lung cancer patients were taken as normal tissue samples . The sequence structure of primers for quantitative detection of miR-139-5p is as follows:

[0052] miR-139-5p RT primer:

[0053] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGGAG (SEQ ID NO. 5)

[0054] miR-139-5p forward primer:...

Embodiment 2

[0058] Example 2. miR-139-5p inhibits tumor cell proliferation

[0059] The base composition of the miR-139-5p mimics sequence used in this example is SEQ ID NO.1 and SEQ ID NO.2, and the sequence has been modified. details as follows:

[0060] Sense strand: mUmCmUACAGUGCACGUGUCUCCmAmGm

[0061] Antisense strand: mAmGmAUGUCACGUGCACAGAGmGmUmC-5chol

[0062] Note: where m stands for methylation, s stands for thiolation, and Chol stands for cholesterol modification. The following embodiments are all the same and will not be repeated.

[0063] Human lung adenocarcinoma cell lines A549 and H460 were from ATCC, and 95D was preserved by our laboratory. Routinely cultivated in RPMI-1640 medium containing 10% fetal bovine serum, placed in an incubator with 5% CO2 and 37°C with saturated humidity for passage.

[0064] Take the A549 and H460 cells in the logarithmic growth phase, and use 4×10 cells per well 3 Cells were seeded in a 96-well plate with a total volume of 100 μL of cel...

Embodiment 3

[0065] Example 3. miR-139-5p arrests tumor cells in G1 phase

[0066] The base composition of the miR-139-5p mimics sequence used in this example is SEQ ID NO.1 and SEQ ID NO.2, and the modification method is the same as in Example 2.

[0067] H460 cells in the logarithmic growth phase were taken at 5×10 per well 4 Cells were seeded in 6-well plates, with a total volume of 2 mL of cell suspension per well, and cultured overnight in a 37°C, 5% CO2 incubator; according to Lipofectamine TM 2000 Reagent Operation Guide for transfection, set Notarget control transfection group, miR-139-5p mimics group, each group set 3 duplicate wells; discard the old medium after 48 hours of transfection, centrifuge to collect cells, and use 75% ethanol Fix overnight; wash the cells twice with PBS-EDTA, and incubate with RNase A at a final concentration of 0.5 mg / mL at room temperature for 30 min to digest the RNA in the cells; add PI solution at a final concentration of 0.05 mg / mL, and incubate a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a miRNA molecule, the base composition of which is SEQ ID NO. 1 or SEQ ID NO.1 and SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4 or SEQ ID NO.10 or the base composition of which is SEQ ID NO. 1 or SEQ ID NO. 1 and SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 and which contains a modified nucleotide analogue, and the modified nucleotide analogue is glycosyl-modified or backbone-modified or base-modified or terminal-modified nucleotide. A medicinal composition for treating tumors, which is prepared from the miRNA molecule, can effectively inhibit the formation and development of tumors.

Description

technical field [0001] The invention belongs to the technical field of biomedical materials, in particular to a miRNA molecule and its application Background technique [0002] MicroRNA (miRNA) is a kind of naturally occurring small non-coding RNA with a length of about 17-25 bases, which is conserved in biology. About one-third of the miRNA sequence in mice is completely consistent with that in humans. The miRNA gene is transcribed into the primary precursor miRNA (pri-miRNA) by RNA polymerase in the nucleus, and then becomes the precursor miRNA (pre-miRNA) after preliminary processing, and then enters the cytoplasm from the nucleus with the assistance of a transport protein, and passes through the cytoplasm. After further processing, it becomes a mature miRNA with a length of about 23 bases. The mature miRNA and related proteins form a miRISC complex to regulate the expression of related proteins. miRNAs are widely involved in the whole process of life from cells to the w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12Q1/68A61K48/00A61P35/00
Inventor 张必良何建行张鑫冯世鹏王玮
Owner GUANGZHOU RIBOBIO
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap