miRNA molecule and application thereof
A molecular and nucleotide technology, applied in the field of miRNA molecules, can solve problems such as lost treatment time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1. Low expression of miR-139-5p in lung cancer tissues and cells
[0051] The primers for quantitative detection of miR-139-5p used in this example were from Guangzhou Ruibo Biotechnology Co., Ltd. The human lung adenocarcinoma cell line A549 is from ATCC, routinely cultured in 1640 culture medium containing 10% fetal bovine serum, and placed in an incubator with 5% CO2 and 37°C saturated humidity for passage. The tissue samples were obtained from the First Affiliated Hospital of Guangzhou Medical College. The informed consent of the patients was obtained before sampling. The use of the samples complied with the relevant medical ethics. The pathological tissue samples from lung cancer patients were taken as normal tissue samples . The sequence structure of primers for quantitative detection of miR-139-5p is as follows:
[0052] miR-139-5p RT primer:
[0053] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGGAG (SEQ ID NO. 5)
[0054] miR-139-5p forward primer:...
Embodiment 2
[0058] Example 2. miR-139-5p inhibits tumor cell proliferation
[0059] The base composition of the miR-139-5p mimics sequence used in this example is SEQ ID NO.1 and SEQ ID NO.2, and the sequence has been modified. details as follows:
[0060] Sense strand: mUmCmUACAGUGCACGUGUCUCCmAmGm
[0061] Antisense strand: mAmGmAUGUCACGUGCACAGAGmGmUmC-5chol
[0062] Note: where m stands for methylation, s stands for thiolation, and Chol stands for cholesterol modification. The following embodiments are all the same and will not be repeated.
[0063] Human lung adenocarcinoma cell lines A549 and H460 were from ATCC, and 95D was preserved by our laboratory. Routinely cultivated in RPMI-1640 medium containing 10% fetal bovine serum, placed in an incubator with 5% CO2 and 37°C with saturated humidity for passage.
[0064] Take the A549 and H460 cells in the logarithmic growth phase, and use 4×10 cells per well 3 Cells were seeded in a 96-well plate with a total volume of 100 μL of cel...
Embodiment 3
[0065] Example 3. miR-139-5p arrests tumor cells in G1 phase
[0066] The base composition of the miR-139-5p mimics sequence used in this example is SEQ ID NO.1 and SEQ ID NO.2, and the modification method is the same as in Example 2.
[0067] H460 cells in the logarithmic growth phase were taken at 5×10 per well 4 Cells were seeded in 6-well plates, with a total volume of 2 mL of cell suspension per well, and cultured overnight in a 37°C, 5% CO2 incubator; according to Lipofectamine TM 2000 Reagent Operation Guide for transfection, set Notarget control transfection group, miR-139-5p mimics group, each group set 3 duplicate wells; discard the old medium after 48 hours of transfection, centrifuge to collect cells, and use 75% ethanol Fix overnight; wash the cells twice with PBS-EDTA, and incubate with RNase A at a final concentration of 0.5 mg / mL at room temperature for 30 min to digest the RNA in the cells; add PI solution at a final concentration of 0.05 mg / mL, and incubate a...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com