Genes related to stress resistance and application to improving stress resistance of plant to environment
An abiotic stress, gene technology, applied in the application, plant products, genetic engineering and other directions, can solve the problems of unsustainable effect and high cost, and achieve the goal of improving plant salt tolerance, abiotic stress tolerance, and abiotic stress tolerance. Effects of biotic stress resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] The cultivation of embodiment 1 transfer Mn-SOD gene, Cu / Zn-SOD gene or Fe / Mn-SOD gene tobacco
[0042] 1. Construction of transgene expression vector
[0043] 1. Acquisition of Mn-SOD gene, Cu / Zn-SOD gene and Fe / Mn-SOD gene
[0044] The present invention clones three SOD genes from a strain of Geobacillus sp. The primers used in PCR are: the upstream primer C of Mn-SOD gene GAGCTC ATGCCATTTGAATTGCCAGC, introduce restriction site SacI, downstream primer C GGATCC TTACTTCGCTTTCGCTTCGC, introducing restriction site BamHI; upstream primer C of Cu / Zn-SOD gene GAGCTC ATGCGAAAAACGTACGGTGTG, the introduction of enzyme cutting site SacI, downstream primer C GGATCC TCACGACGACTTGATTTCCC, introducing restriction site BamH I; upstream primer C of Fe / Mn-SOD gene GGATCC ATGCGTGGGGCAAGCAC, introduce restriction site BamHI, downstream primer C TCTAGA TTAAAACGGCTGCCAACG, introduce restriction site XbaI. The PCR amplification system was 50 μL, and 1 μL of genomic DNA was used...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com