Genes related to stress resistance and application to improving stress resistance of plant to environment

An abiotic stress, gene technology, applied in the application, plant products, genetic engineering and other directions, can solve the problems of unsustainable effect and high cost, and achieve the goal of improving plant salt tolerance, abiotic stress tolerance, and abiotic stress tolerance. Effects of biotic stress resistance

Inactive Publication Date: 2012-08-01
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are more or less insurmountable shortcomings in many improvement measures. For example, using fresh water to drain salt will drain other nutrients in the soil together, and the rest have shortcomings such as unsustainable eff

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genes related to stress resistance and application to improving stress resistance of plant to environment
  • Genes related to stress resistance and application to improving stress resistance of plant to environment
  • Genes related to stress resistance and application to improving stress resistance of plant to environment

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0041] Example 1 Cultivation of transgenic tobacco with Mn-SOD gene, Cu / Zn-SOD gene or Fe / Mn-SOD gene

[0042] 1. Construction of transgene expression vector

[0043] 1. Acquisition of Mn-SOD gene, Cu / Zn-SOD gene and Fe / Mn-SOD gene

[0044] The present invention clones three SOD genes from a strain of Geobacillus sp. The primers used in PCR are: the upstream primer C of Mn-SOD gene GAGCTC ATGCCATTTGAATTGCCAGC, introduce restriction site SacI, downstream primer C GGATCC TTACTTCGCTTTCGCTTCGC, introduce restriction site BamHI; the upstream primer C of Cu / Zn-SOD gene GAGCTC ATGCGAAAAACGTACGGTGTG, introduce restriction site SacI, downstream primer C GGATCC TCACGACGACTTGATTTCCC, introduce restriction site BamH I; the upstream primer C of Fe / Mn-SOD gene GGATCC ATGCGTGGGGCAAGCAC, introduce restriction site BamHI, downstream primer C TCTAGA TTAAAACGGCTGCCAACG, introduce restriction site XbaI. The PCR amplification system is 50μL, and 1μL genomic DNA is used as the template. The amplif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses genes related to stress resistance and application to improving stress resistance of a plant to environment. According to the invention, three SOD (Super Oxygen Dehydrogenises) genes, i.e., Mn-SOD gene, Cu/Zn-SOD gene and Fe/Mn-SOD gene, are separated from geobacillus sp., wherein the nucleotide sequences of the three genes are shown as SEQ ID No. 1, SEQ ID No. 2 or SEQ ID No. 3 respectively. The invention further provides application of the SOD genes to improving stress resistance of the plant to environment. The application comprises the following steps of: constructing a plant expression vector containing the SOD genes; transforming the constructed plant expression vector into planet cells or plant tissues; and regenerating to obtain transgenic plant strain with improved stress resistance to non-living things.

Description

technical field [0001] The present invention relates to stress resistance-related genes and applications thereof, in particular to three SOD genes isolated and cloned from Geobacillus sp and their application in improving plant resistance to abiotic stress, belonging to plant stress resistance field of molecular biology. Background technique [0002] Abiotic stresses such as drought and salinity have seriously affected plant growth and crop yield, and the damage to agricultural production is worldwide (Boyer JS, Science, 1982; 218: 443-448). Abiotic stress is the main cause of crop yield reduction, which can lead to an average crop yield reduction of 50% to 80%. Plants have a variety of molecular, cellular, physiological and biochemical mechanisms to resist and adapt to various abiotic stresses. Although the genes and molecular mechanisms of plant resistance to abiotic stress have not been fully elucidated so far, they can be resisted from many aspects such as genetics, cel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/53C12N15/82A01H5/00
Inventor 李轶女张志芳潘沈元姚冉叶兴国王金辉杨灵王国增沈桂芳
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap