Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe set and kit for detecting AIDS-related mycoplasmas

A detection kit and primer combination technology, applied in the field of molecular biology, can solve the problems of increased clinical detection workload and detection cost, general PCR detection sensitivity, and reduced detection efficiency, so as to simplify the detection workload, shorten the detection time, The effect of fast sensitivity

Active Publication Date: 2012-11-21
ICDC CHINA CDC
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The sensitivity of PCR detection is average, and it is time-consuming and labor-intensive to detect and interpret the results of the three kinds of mycoplasma respectively, which greatly increases the clinical detection workload and detection cost, and reduces the detection efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe set and kit for detecting AIDS-related mycoplasmas
  • Primer, probe set and kit for detecting AIDS-related mycoplasmas
  • Primer, probe set and kit for detecting AIDS-related mycoplasmas

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 3

[0055] The design of embodiment 1 triple fluorescent PCR primers and probes

[0056] Probes and primers were designed by using the Beacon Designer7 software for the conserved regions in the ftsZ gene of Mycoplasma penetratingum, the ftsZ gene of Mycoplasma fermentans and the rpoB gene of Mycoplasma pirum reported in the NCBI database. The probe types are all TaqMan probes, in which the penetrating mycoplasma probe is 5' labeled with the fluorescent group FAM and 3' labeled with the quencher group BHQ1; the fermentation mycoplasma probe is 5' labeled with the fluorescent group HEX and 3' labeled with the quencher Group BHQ1; Mycoplasma pear probe 5' labeled fluorescent group ROX, 3' labeled quencher group BHQ2.

[0057] The primer sequence for detecting mycoplasma is:

[0058] Mpen-F:ACGTGAGTTAACCATGTA (SEQ ID NO.1)

[0059] Mpen-R: GGTTCGTCTTTCTATCTAATAG (SEQ ID NO. 2);

[0060] The primer sequence for detecting Mycoplasma fermentum is:

[0061] Mfer-F: TGCTGTTTCAATGTCATC ...

Embodiment 2 3

[0072] Example 2 The optimization of triple fluorescent quantitative PCR annealing temperature

[0073] The present invention respectively detects Mycoplasma penetrans ATCC55252, Mycoplasma fermentans ATCC19989 and Mycoplasma pirum ATCC25960 by single-plex fluorescent PCR detection ( Figure 1~3 ), and change the annealing temperature to select the optimal annealing temperature for the multiplex system. It was found that the optimal annealing temperature for the reaction of Mycoplasma penetratum and Mycoplasma fermentum was 59°C, and the optimum annealing temperature for Mycoplasma pirum was 57°C, and the amplification effect of the system was the best at this temperature. Taking the above factors into consideration, the annealing temperature range of the triple fluorescent quantitative PCR system was set at 57°C to 60°C.

Embodiment 3 3

[0074] Embodiment 3 Triple fluorescent quantitative PCR amplification system and amplification conditions

[0075] The real-time fluorescence quantitative PCR amplification system is:

[0076]

[0077]

[0078] Amplification conditions:

[0079] 95℃ 3min

[0080]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a primer and probes of triplex fluorescent PCR detection which are suitable for simultaneously detecting three kinds of AIDS-related mycoplasmas by genetic sequencing and comparison of AIDS-related mycoplasmas (mycoplasma penetrans, mycoplasma fermentans and mycoplasma pirum). The primer and probes disclosed herein are represented by the nucleotide sequences of SEQ ID NO.1-9. The invention further provides a method and a kit for detecting the AIDS-related mycoplasmas. The detection kit and detection reagent disclosed in the invention have the advantages of accurate detection, high sensitivity, strong specificity, simpleness and rapidness, and good detection capability.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to fluorescent quantitative PCR primers, probes and kits for detecting AIDS-related mycoplasma. AIDS-associated Mycoplasma are Mycoplasma penetrans, Mycoplasma fermentans and Mycoplasma pirum. Background technique [0002] AIDS-associated Mycoplasma generally refers to Mycoplasma penetrans, Mycoplasma fermentans and Mycoplasma pirum. These three mycoplasmas play the role of cofactors or facilitators in the development of HIV infection and AIDS, and have a significant correlation with the onset of AIDS, so they are called AIDS-associated mycoplasma (references: Montagnier L, Blanchard A. Mycoplasmas as co-factors in infection due to the human immunodeficiency virus [J]. Clin infection Dis, 1993, 17: 5309.). If an AIDS patient is diagnosed with Mycoplasma penetratum, Mycoplasma fermentum and Mycoplasma pirum, targeted treatment based on the existing treatment plan can reduce the cha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/35
Inventor 赵飞张建中王艳冬肖迪张慧芳何利华孟凡亮
Owner ICDC CHINA CDC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products