MiRNA (micro ribose nucleic acid)-874 and application of miRNA-874antisense nucleotide
A technology of miRNA-874 and antisense nucleotides, which can be used in medical preparations containing active ingredients, gene therapy, cardiovascular system diseases, etc., and can solve the problem of unidentified key miRNAs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 The heart weight ratio and cardiac function of miRNA-874 transgenic mice are comparable to those of wild type no significant change than
[0041] Heart weight ratio analysis was performed on the hearts of miRNA-874 transgenic mice and wild-type mice, and the number of samples for each of the two groups of mice was 26. Experimental results such as figure 1 A shows that miRNA-874 transgenic mice have no significant increase in heart weight ratio compared with wild-type mice, indicating that miRNA-874 transgenic mice themselves have no obvious changes in hypertrophic phenotype.
[0042] The indicators of cardiac function detected at the same time include left ventricular posterior wall thickness (LVPWd) and fractional shortening (FS). Such as figure 1 As shown in B, the experimental results showed no significant difference in heart function between miRNA-874 transgenic mice and wild-type mice.
experiment example 2
[0043] Experimental Example 2 miRNA-874 transgenic mice were stimulated with PE (phenylephrine) and wild Heart weight ratio and heart function have been significantly changed compared with raw mice
[0044] The hearts of miRNA-874 transgenic mice and wild-type mice were injected with hypertrophy-stimulating factor PE. Among them, 6 miRNA-874 transgenic mice and 6 wild-type mice were used, and the dosage of PE was 75mg / kg / day. The control groups were miRNA-874 transgenic mice and wild-type mice treated with saline instead of PE. Heart-to-weight ratio analysis was performed after two weeks, see figure 2 A in Experimental results such as figure 2 As shown in A, the heart weight ratio of miRNA-874 transgenic mice after PE treatment was significantly increased compared with the control group, indicating that miRNA-874 transgenic mice after PE treatment had obvious hypertrophic phenotype changes .
[0045] The detection of cardiac function includes LVPWd (left ventricula...
experiment example 3
[0046] Experimental example 3 Changes in the expression level of miRNA-874 under the stimulation of PE and endothelin (ET-1) change
[0047] For the hypertrophy model of cardiomyocytes, adopt the method established in our laboratory to culture the primary cardiomyocytes of rat suckling rats, and treat the cardiomyocytes with PE and ET-1 (the dosage of PE is 50μM; the dosage of ET-1 is 100nM) , at different times in culture, extract the total RNA of the cells, and use real-time fluorescent quantitative PCR technology to detect (see the following literature: W.-Q.Tan, Kun Wang, et al., Foxo3a Inhibits Cardiomyocyte Hypertrophy through Transactivating Catalase.J Biol Chem.2008 October 31;283(44):29730-29739)
[0048] Specifically, the gene sequence of miRNA-874 was amplified by PCR
[0049] (TTAGCCCTGCGGCCCCACGCACCAGGGTAAGAGAGACTCGCTTCCTGCCCTGGCCCGAGG, SEQ ID NO: 3) and its upstream and downstream sequences of nearly 200 bp each, the amplified fragment is about 476bp, specif...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com