Preparation method of fish iridovirus DNA (Deoxyribonucleic Acid) vaccine

A DNA vaccine and iridescent virus technology, applied in the field of biomedicine, can solve the problems of restricting the promotion of vaccines and high production costs of vaccines

Inactive Publication Date: 2013-04-17
SHANGHAI QIHAIFUTAI BIOLOGICAL TECH
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The iridescent virus vaccines under domestic research and development are also prepared by inactivation methods. The cultivation of the virus makes the production cost of the vaccine very expensive, which limits the promotion of the vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of fish iridovirus DNA (Deoxyribonucleic Acid) vaccine
  • Preparation method of fish iridovirus DNA (Deoxyribonucleic Acid) vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1: the preparation of DNA vaccine

[0019] Vector build:

[0020] The nucleotide sequence of the whole gene synthesis fragment Pcmv-MCP-SV40 pA-Pcmv-ankyrin repeats-SV40 pA, MCP and ankyrin repeats is attached. This fragment is homologous recombination (GBI) with the 2k fragment on the plasmid pBR322. The reaction system is: 15ul GBclonart reaction solution; 1ul pBR322 fragment; 2ul whole gene synthesis fragment; 2ul ddH2O. After incubating at 50°C for 30 min, 5ul was taken to transform Escherichia coli DH5a. Ampicillin LB solid plate screening. The correct clone was verified by sequencing, expanded culture in 500ml LB medium, and a large number of plasmids were extracted for future use. The formula of the liquid LB medium is: 0.5% yeast extract; 1% peptone; 1% sodium chloride, the pH value of the bar is 7.0, sterilized at 121°C for 15 minutes. The solid LB medium is to add 1.5% agar powder on the basis of the liquid LB medium;

[0021] DNA vaccine f...

Embodiment 2

[0023] Embodiment 2: Taking turbot as object's immune protection experiment by injection

[0024] The experimental turbot were randomly divided into 14 groups, each group had 3 tanks, and 10 fish / tank. The prepared DNA vaccine was immunized by intramuscular injection, the injection volume was 1ug / tail and 10ug / tail, and the control was physiological saline. After 4 weeks of immunization, challenge with iridovirus (105CFU / tail). After 15 days, the number of deaths was observed, and the immune protection rate of each group was calculated (see Table 1).

[0025] Table 1

[0026]

[0027] It can be seen from the above that the DNA vaccine has a good control effect on iridescent virus, and the immune protection rate is 82%.

[0028] 1. MCP nucleotide sequence:

[0029]atgtctgcaatctcaggtgcgaacgtaaccagtgggttcatcgacatctccgctttcgatgcgatggagacccacttgtacggcggcgacaatgccgtgacatactttgcccgcgagaccgtgcgtagttcctggtacagcaaactacccgtcaccctgtcaaaacagactggccatgccaa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fish iridovirus DNA (Deoxyribonucleic Acid) vaccine which comprises an eukaryotic transcription promoter, a gene of an iridovirus major capsid protein (MCP), an ankyrinrepeats gene, an eukaryotic transcription terminator, a replication initiation site and a resistance screening marker (shown in figure 1), wherein the replication initiation site and the resistance screening marker are used for amplifying plasmids. The DNA vaccine is recommended to be injected by an intramuscular injection method and can also be taken by oral and soaking modes to enable fish to be immune.

Description

technical field [0001] The invention belongs to the field of biomedicine, in particular to a method for preparing a DNA vaccine in aquaculture, in particular to a method for preparing a DNA vaccine for preventing and treating iridovirus. Background technique [0002] The invention relates to the construction of a vector for encoding and expressing the immunogen of fish iridescent virus. The iridescent virus is a pathogenic virus that causes huge losses in fishery production, and the lethality rate is as high as 60%. This patent relates to the method for producing and preparing the vaccine, and also relates to the vaccination method of the iridescent virus DNA vaccine. [0003] Iridovirus mainly infects invertebrates and lower vertebrates. It is a large 20-hedron shaped DNA virus, which is divided into Iridovirus, Chloriridovirus, Lymphocystivirus, Ranavirus ( Ranavirus) and cytomegalovirus (Megalocytivirus). The iridoviruses that cause huge losses in aquaculture include re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K39/12A61P31/20C12N15/66
Inventor李琦滕以刚
OwnerSHANGHAI QIHAIFUTAI BIOLOGICAL TECH