Recombinant corynebacterium glutamicum capable of being used for highly yielding L-phenylalanine and application thereof
A technology of Corynebacterium glutamicum, phenylalanine, applied in bacteria, microorganism-based methods, microorganisms, etc., can solve the problems of limited sources, high cost, poor enzyme stability, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Construction and Identification of Embodiment 1 Recombinant Bacteria
[0026] According to the Genebank accession sequence number NC_000913.2, the aroF gene was amplified by PCR (primer F: CCAATGCAT AAAGGAGGA CACGC ATGCAAAAA
[0027] GACGCGCTGAATAACG; R: CTAG TCTAGA TTAAGCCACGCGAG
[0028]CCGTCA), cloned into the shuttle vector pXMJ19 (Jakoby, M., C.E. Ngouoto-Nkili, and A. Burkovski, Construction and application of new Corynebacterium glutamicum vectors. Biotechnology Techniques, 1999.13(6): p.437-441.), finally The shuttle expression plasmid pXMJ19-aroF containing the aroF gene was obtained. According to the plasmid pAP-B03 (Zhou, H., X.Liao, T.Wang, G.Du, and J.Chen. 2010.Enhanced L-phenylalanine biosynthesis by co-expression of pheA fbr and aroF wt .Bioresour Technol101:4151-4156.) The gene pheA that acquires anti-feedback inhibition fbr (Primer F: CCC AAGCTT AAAGGAGGACACGCATGACATCGGAAAACCCGTTACT; R:AAAA CTGCAG TCAGGTT
[0029] GGATCAACAGGCACTA) obtain...
Embodiment 2
[0034] Embodiment 2 fermentation produces L-Phe
[0035] The recombinant strain C. glutamicum was compared with the starting strain in the fermentation experiment. In C.glutamicum ATCC13032, the shikimic acid metabolic pathway of L-Phe synthetic metabolic pathway was overexpressed, and the key enzyme gene of chorismic acid metabolic pathway made the production of L-Phe reach 3.47g / L. The highest yield of L-Phe of each enzyme gene was 4.86gL. However, the production of L-Phe could not be detected during the fermentation process of the fermentation broth of the starting strain C. glutamicum ATCC13032.
[0036]
[0037]
[0038]
[0039]
PUM
Property | Measurement | Unit |
---|---|---|
specific rotation | aaaaa | aaaaa |
wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com