Recombined Tbeta 4-BP5 fusion peptide, gene, engineering bacteria and application

A technology of fusing peptides and engineering bacteria, applied in the field of bioengineering, can solve the problems of unsuitability for field promotion, high content of miscellaneous proteins, difficult purification, etc., to enhance the level of cellular immunity and humoral immunity of the body, broad application prospects, good immunity The effect of adjuvant effect

CN103145854BInactive Publication Date: 2014-11-26HENAN UNIV OF SCI & TECH
5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Publication Date
2014-11-26
Estimated Expiration
Not applicable · inactive patent

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a recombined Tbeta 4-BP5 fusion peptide, a gene, an engineering bacteria and an application. The recombined fusion peptide is prepared by fusing thymosin beta 4 with Fabricius bursa pentapeptide BP5 through a soft Linker. The recombined Tbeta 4-BP5 fusion peptide gene is inserted into an expression vector to transfer the escherichia coli so as to obtain the gene engineering bacteria for effectively express the Tbeta 4-BP5 fusion peptide; the Tbeta 4-BP5 fusion peptide is prepared through liquid cultivation and purification; and the thioredoxin of the fusion peptide is eliminated by using enterokinase with His tag at the N-end, and the fusion peptide is further subjected to affinity chromatography purification so as to obtain the single recombined Tbeta 4-BP5 fusion peptide. The recombined Tbeta 4-BP5 fusion peptide disclosed by the invention can be used as a novel polypeptide immunologic adjuvant which is used in match with vaccines, can effectively enhance the organism cell immune level and the body liquid immune level, and has wide application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to a recombinant fusion peptide of thymosin β4 and Bursa pentapeptide BP5, and also relates to a gene encoding the recombinant fusion peptide, an engineering bacterium expressing the fusion peptide and its application, belonging to the technical field of bioengineering. Background technique

[0002] The thymus is an important central immune organ in the immune system, responsible for cell differentiation and maturation. Thymosin is a general term for a variety of biologically active polypeptide substances secreted by the thymus, also known as thymosin. Thymosin β4 (Tβ4) is a small peptide isolated from the thymus in the 1980s and later found to be widely present in many tissues. Thymosin β4 is an important actin-binding protein, containing 43 amino acids, with a molecular weight of about 5kD and an isoelectric point of 5.1. Its amino acid sequence is as follows:

[0003] Ser-Asp-Lys-Pro-Asp-Met-Ala-Glu-Ile-Glu-Lys-Phe-Asp-Lys-Ser...

Examples

Embodiment 1

[0047] 1. Design primers

[0048] The recombinant Tβ4-BP5 fusion peptide gene was designed according to the codon bias of Escherichia coli, as follows: 5'-ACTGACAAACCTGACATGGCCGAGATCGAGAAATTCGACAAATCGAAGCTCAAGAAGACTGAGACTCAAGAGAAGAATCCACTACCATCGAAGGAGACGATCGAGCAGGAGAAGCAAGCTGGCGAGTCCGGCGGCGGCGGCAGCTGCAAAAATGTGTAT-3' (SEQ ID NO: 1)

[0049] And design primer F for this fusion peptide gene 1 , F 2 and F 3 , where in primer F 1 Add EcoRI restriction site, primer F 3 Add stop codon and XbaI restriction site. The expression design diagram of the recombinant Tβ4-BP5 fusion peptide is shown in figure 1 , the primers were synthesized by Shanghai Invitrongen Company, as follows:

[0050] f 1 : 5'-CCG GAATTC ACTGACAAACCTGACATGGCCGAGATCGAGAAATTCGACAAATCGAAGCTCAAGAAGACTGA-3' (SEQ ID NO: 2), where the underlined part is the EcoRI restriction site;

[0051] f 2 : 5'-TCTCCTGCTCGATCGTCTCCTTCGATGGTAGTGGATTCTTCTCTTGAGTCTCAGTCTTCTTG-3' (SEQ ID NO: 3);

[0052] f 3 : 5'-TCGAGCAGGAGAA...

Embodiment 2

[0058] The recombinant Tβ4-BP5 fusion peptide gene of Example 1 and the plasmid vector pET32a were digested with EcoRI and XbaI, and placed in a 37°C water bath for 2 hours. After the digested products were identified by 1% agarose gel electrophoresis, the gel recovery reagent boxes for recovery identification. The digested recombinant Tβ4-BP5 fusion peptide gene and plasmid vector pET32a were ligated at a molar ratio of 1:3 overnight at 4°C. Take the ligation product and add it to a polypropylene centrifuge tube containing 100 μL of competent DH5α, mix gently and then ice-bath for 30 min. After the polypropylene centrifuge tube was taken out of the ice, it was heat-shocked at 42°C for 90 seconds, and then immediately ice-bathed for 2 minutes. Take it out and add it to 800 μL of LB medium preheated at 37°C, and shake (120rpm) at 37°C for 45min. Take 100 μL of the bacterial solution and spread it evenly on the agar LB plate containing 50 μg / mL of ampicillin (Amp), place it at...

Embodiment 3

[0061] The positive recombinant prokaryotic expression vector pET32a-Tβ4-BP5 obtained in Example 2 was transferred to a polypropylene centrifuge tube containing 200 μL of competent cells BL21, mixed gently and then ice-bathed for 30 minutes. Take it out and place it in a 42°C water bath, heat shock for 90s, and then immediately ice bath for 2min. Add 800 μL of 37°C preheated LB medium, and shake at 37°C for 45 minutes. Take 100 μL of the bacterial solution and evenly spread it on the agar LB plate (1 μg / mL ampicillin), place it upright at 37°C for 20 minutes, and incubate it upside down for 18 hours.

[0062] Pick a single colony from the agar LB plate (1 μg / mL ampicillin), inoculate it into 3 mL LB medium (1 μg / mL ampicillin), culture with shaking at 37 °C overnight, and transfer to 5 mL LB medium (1 μg / mL ampicillin) the next day ampicillin) at 37°C for 3 h with shaking, take 3 mL of the bacterial solution, and extract the plasmid according to the instructions of the rapid ...