Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system

A transgene and recombinase technology, applied in the biological field, can solve problems such as the establishment of a site-specific integration technology system, and achieve high-efficiency expression

Inactive Publication Date: 2013-08-07
SOUTHWEST UNIVERSITY
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the site-specific integration technology system based on the phiC31 / att system has not been established at the silkworm individual level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system
  • Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system
  • Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Construction of the silkworm transgenic recombinant vector pBac{3×P3-DsRed;attP / attP}

[0040] According to the current requirements of the silkworm to prepare transgenic silkworms based on piggyBac transposable vectors, the silkworm transgenic recombinant vector pBac{3×P3-DsRed;attP / attP}( figure 1 A). The specific steps are as follows: Synthesize attP1-SpeI / XhoI-F: 5’- ctagt ccccaactggggtaacctttgagttctctcagttggggg c -3’ (SEQ ID NO.1), attP1-SpeI / XhoI-R5’- tcgag cccccaactgagagaactcaaaggttaccccagttgggg a -3’ (SEQ ID NO.2), attP2-SphI / BglII-F: 5’-ccccaactggggtaacctttgagttctctcagttggggg a -3’ (SEQ ID NO.3) and attP2-SphI / BglII-R: 5’- gatct cccccaactgagagaactcaaaggttaccccagttgggg catg -3' (SEQ ID NO.4) four nucleotide sequences, underlined indicates the sticky end of the restriction site. The synthesized SEQ ID NO.1 and SEQ ID NO.2 were pre-denatured at a temperature of 95°C for 5 minutes, then cooled by 1°C every 60s, kept at 25°C for 5 minutes, and finally stored at 4...

Embodiment 2

[0058] 1. The establishment of transgenic target strains

[0059] Using the diapause silkworm strain Dazao as the original material, the parent silkworm eggs were treated with low temperature incubation at 16℃ to relieve the diapause of the offspring silkworm eggs; the recombinant vector pBac{3×P3 with a total concentration of 10-15nL of 400ng / μL -DsRed; attP / attP} and the helper plasmid pHA3PIG are injected into 294 G0 silkworm eggs that have been released from diapause, sealed with non-toxic glue and placed in an environment at 25°C and 85% relative humidity for incubation , Hatched 80 G0 generation silkworms, and then raised them with mulberry leaves to turn moths to obtain 74 G0 generation silkworm moths. The obtained silkworm moths were backcrossed to obtain a total of 40 G1 generation silkworm eggs. Observed by a motorized macroscopic fluorescence microscope, and then screened the moth circles that emit red fluorescence, the result is as follows Figure 4 Shown. After scre...

Embodiment 3

[0063] Using the diapause silkworm strain Dazao as the original material, the parent silkworm eggs were treated with low temperature incubation at 16℃ to relieve the diapause of the offspring silkworm eggs. The recombinant vector pBac{3×P3 with a total concentration of 10-15nL of 400ng / μL -DsRed;attB / attB} and the helper plasmid pHA3PIG are injected into 108 G0 silkworm eggs that have been released from diapause, sealed with non-toxic glue and placed in a high humidity environment at 25℃ and 85% relative humidity. Green hatching, 10 hatched G0 silkworm mulberry leaves were collected and fed to moths, and 8 G0 silkworm moths were obtained. A total of 50 G1 silkworm eggs were obtained through backcrossing. Motorized macroscopic fluorescence microscope observation, the results are as follows Picture 10 Shown. Through observation and screening, one moth circle with red fluorescence was obtained, and a total of 1 positive transgenic silkworm with red fluorescence in the eye was obt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a phiC31 recombinase system and a piggyBac transposon and a fixed point transgenetic system of silkworm and a preparation method of the fixed point transgenetic system. According to the invention, the phiC31 recombinase system and the transgenic technology for mediating the silkworm to transform by the piggyBac transposon are combined; first, two attB sites or attP sites which are arranged in the same direction are connected into a piggyBac transposon carrier; the carrier in transformed into silkworm; then, single copy transgenetic silkwork is screened to be used as a target system; then, the target system is transformed by using the phiC31 recombinase and a carrier, wherein target gene expression frames are anchored at the two ends of the carrier by the attB sites or attP sites which are arranged in the same direction; and thus the target gene expression frames are transformed to the place between fixed points, namely the two attB sites or attP sites of the piggyBac transposon carrier, thereby realizing the purpose of fixed point transgene of silkwork. The method is simple to operate and provides a powerful tool for genetic function research for silkworm.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of a phiC31 recombinase system and piggyBac transposon in preparing a silkworm site-specific transgene, and also relates to a silkworm site-directed transgene system containing a phiC31 recombinase system and a piggyBac transposon and the use of the system The method of preparing designated transgenic silkworm. Background technique [0002] China is a big silk country and the birthplace of the ancient Silk Road. The silkworm is currently one of the most successful and longest economic insects used by humans in the world. The domestication and breeding of the silkworm has a history of about 5,000 years. As a very important Lepidopteran model organism, Bombyx mori has important value and significance for in-depth research. With the completion of the silkworm genome framework map, fine map and genetic mutation map, it marks the silkworm genome research has gradu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/00C12N15/11C12N15/63C12N15/52
Inventor赵爱春龙定沛陆威健郭庆向仲怀
OwnerSOUTHWEST UNIVERSITY