Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system
A transgene and recombinase technology, applied in the biological field, can solve problems such as the establishment of a site-specific integration technology system, and achieve high-efficiency expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Construction of the silkworm transgenic recombinant vector pBac{3×P3-DsRed;attP / attP}
[0040] According to the current requirements of the silkworm to prepare transgenic silkworms based on piggyBac transposable vectors, the silkworm transgenic recombinant vector pBac{3×P3-DsRed;attP / attP}( figure 1 A). The specific steps are as follows: Synthesize attP1-SpeI / XhoI-F: 5’- ctagt ccccaactggggtaacctttgagttctctcagttggggg c -3’ (SEQ ID NO.1), attP1-SpeI / XhoI-R5’- tcgag cccccaactgagagaactcaaaggttaccccagttgggg a -3’ (SEQ ID NO.2), attP2-SphI / BglII-F: 5’-ccccaactggggtaacctttgagttctctcagttggggg a -3’ (SEQ ID NO.3) and attP2-SphI / BglII-R: 5’- gatct cccccaactgagagaactcaaaggttaccccagttgggg catg -3' (SEQ ID NO.4) four nucleotide sequences, underlined indicates the sticky end of the restriction site. The synthesized SEQ ID NO.1 and SEQ ID NO.2 were pre-denatured at a temperature of 95°C for 5 minutes, then cooled by 1°C every 60s, kept at 25°C for 5 minutes, and finally stored at 4...
Embodiment 2
[0058] 1. The establishment of transgenic target strains
[0059] Using the diapause silkworm strain Dazao as the original material, the parent silkworm eggs were treated with low temperature incubation at 16℃ to relieve the diapause of the offspring silkworm eggs; the recombinant vector pBac{3×P3 with a total concentration of 10-15nL of 400ng / μL -DsRed; attP / attP} and the helper plasmid pHA3PIG are injected into 294 G0 silkworm eggs that have been released from diapause, sealed with non-toxic glue and placed in an environment at 25°C and 85% relative humidity for incubation , Hatched 80 G0 generation silkworms, and then raised them with mulberry leaves to turn moths to obtain 74 G0 generation silkworm moths. The obtained silkworm moths were backcrossed to obtain a total of 40 G1 generation silkworm eggs. Observed by a motorized macroscopic fluorescence microscope, and then screened the moth circles that emit red fluorescence, the result is as follows Figure 4 Shown. After scre...
Embodiment 3
[0063] Using the diapause silkworm strain Dazao as the original material, the parent silkworm eggs were treated with low temperature incubation at 16℃ to relieve the diapause of the offspring silkworm eggs. The recombinant vector pBac{3×P3 with a total concentration of 10-15nL of 400ng / μL -DsRed;attB / attB} and the helper plasmid pHA3PIG are injected into 108 G0 silkworm eggs that have been released from diapause, sealed with non-toxic glue and placed in a high humidity environment at 25℃ and 85% relative humidity. Green hatching, 10 hatched G0 silkworm mulberry leaves were collected and fed to moths, and 8 G0 silkworm moths were obtained. A total of 50 G1 silkworm eggs were obtained through backcrossing. Motorized macroscopic fluorescence microscope observation, the results are as follows Picture 10 Shown. Through observation and screening, one moth circle with red fluorescence was obtained, and a total of 1 positive transgenic silkworm with red fluorescence in the eye was obt...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com