Matrix serum/plasma miRNA (Micro Ribonucleic Acid) marker associated with fetal congenital heart diseases and application of marker
A technology of congenital heart disease and markers, applied in the fields of genetic engineering and reproductive medicine, can solve problems such as consistency to be explored, achieve accurate, objective and reliable results, simple operation, and improve the possibility and feasibility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] 1. Test materials: miVana PARIS kit, Taqman MicroRNA reverse transcription kit, Taqman gene expression mix, Taqman MicroRNA assay-hsa-mir-19b (Assay ID: 000396), taqman MicroRNA assay-has-mir-22 (Assay ID: 000398) , taqman MicroRNA assay-has-mir-29c (Assay ID: 000587), taqman MicroRNA assay-has-mir-375 (Assay ID: 000564), taqman MicroRNA assay-cel-mir-39 (Assay ID: 000200) are all purchased From the American ABI company. The artificially synthesized cel-mir-39 mature body was purchased from Invitrogen (sequence: UCACCGGGUGUAAAUCAGCUUG (SEQ ID No.5)).
[0045] 2. Collection of samples and arrangement of sample data: the inventor has collected a large number of peripheral blood samples of pregnant women at 22-28 weeks of gestation from Nanjing Maternal and Child Health Hospital since 2011 (the blood samples used for research are collected, packaged, preserved conditions are the same). After sorting out the sample data, the inventor selected 60 samples as the experimenta...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com