Check patentability & draft patents in minutes with Patsnap Eureka AI!

Matrix serum/plasma miRNA (Micro Ribonucleic Acid) marker associated with fetal congenital heart diseases and application of marker

A technology of congenital heart disease and markers, applied in the fields of genetic engineering and reproductive medicine, can solve problems such as consistency to be explored, achieve accurate, objective and reliable results, simple operation, and improve the possibility and feasibility

Inactive Publication Date: 2013-09-11
NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, the source of serum / plasma miRNA has not yet been determined. Some researchers believe that the miRNA in serum / plasma of tumor patients comes from the target tissue, but the consistency between its expression changes and the target tissue remains to be explored; Selectively enriched into "microparticles (MPs)" or "exosomes", which are actively secreted by cells in the form of "microvesicles" shedding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Matrix serum/plasma miRNA (Micro Ribonucleic Acid) marker associated with fetal congenital heart diseases and application of marker
  • Matrix serum/plasma miRNA (Micro Ribonucleic Acid) marker associated with fetal congenital heart diseases and application of marker
  • Matrix serum/plasma miRNA (Micro Ribonucleic Acid) marker associated with fetal congenital heart diseases and application of marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] 1. Test materials: miVana PARIS kit, Taqman MicroRNA reverse transcription kit, Taqman gene expression mix, Taqman MicroRNA assay-hsa-mir-19b (Assay ID: 000396), taqman MicroRNA assay-has-mir-22 (Assay ID: 000398) , taqman MicroRNA assay-has-mir-29c (Assay ID: 000587), taqman MicroRNA assay-has-mir-375 (Assay ID: 000564), taqman MicroRNA assay-cel-mir-39 (Assay ID: 000200) are all purchased From the American ABI company. The artificially synthesized cel-mir-39 mature body was purchased from Invitrogen (sequence: UCACCGGGUGUAAAUCAGCUUG (SEQ ID No.5)).

[0045] 2. Collection of samples and arrangement of sample data: the inventor has collected a large number of peripheral blood samples of pregnant women at 22-28 weeks of gestation from Nanjing Maternal and Child Health Hospital since 2011 (the blood samples used for research are collected, packaged, preserved conditions are the same). After sorting out the sample data, the inventor selected 60 samples as the experimenta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering and reproductive medicine and discloses a matrix serum / plasma miRNA (Micro Ribonucleic Acid) marker associated with fetal congenital heart diseases and an application of the marker. The marker is the combination of several of mi-19b, mir-22, mir-29c and mir-375. The marker can be used for well separating cases of fetal congenital heart diseases from healthy controls and can play a good supporting role in early diagnosis of fetal congenital heart diseases.

Description

field of invention [0001] The invention belongs to the fields of genetic engineering and reproductive medicine, and relates to a maternal serum / plasma miRNA marker related to fetal congenital heart disease and application thereof. Background technique [0002] Congenital heart disease (CHD) is a congenital malformation of the heart and great vessels caused by the abnormal development or partial stop of the fetal heart and great vessels in the mother's body. , is a common congenital malformation. About 5‰-8‰ newborns suffer from CHD every year, which is 6 times higher than chromosomal abnormalities and 4 times higher than neural tube defects. Most of the children need surgical correction after birth. Without treatment, about 1 / 3 of the children will die due to severe illness and complex deformities within 1 year after birth. Therefore, early diagnosis, early intervention, and timely and reasonable treatment are the keys to reducing the morbidity and mortality of CHD, and ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 韩树萍余章斌曹荔钱玲梅朱莎莎郭锡熔孔丽萍朱春朱金改潘亚
Owner NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More