Riemerella anatipestifer-escherichia coli shuttle expression vector as well as construction method and application thereof

A shuttle expression vector, technology of Riemer's anatipestifer, applied in the field of Riemerella anatipestifer-Escherichia coli shuttle expression vector and its construction

Active Publication Date: 2013-10-23
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF3 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on the Riemerella anatipestifer-Escherichia coli shuttle expression vector and related patent publications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Riemerella anatipestifer-escherichia coli shuttle expression vector as well as construction method and application thereof
  • Riemerella anatipestifer-escherichia coli shuttle expression vector as well as construction method and application thereof
  • Riemerella anatipestifer-escherichia coli shuttle expression vector as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction of Riemerella anatipestifer-Escherichia coli shuttle expression vector

[0032] Described Riemerella anatipestifer is any Riemerella anatipestifer bacterial strain, the Riemerella anatipestifer CH used in this example 3 strain and YXL3 strain were isolated and identified from domestic diseased duck heart blood and liver by the inventor (both serotype 1); the Escherichia coli is an engineering strain of Escherichia coli, such as S 17-1 λpir, CC118 λpir, SM10 λpir and DH5a λpir etc., the Escherichia coli S 17-1 λpir strain used in this example was purchased from Spain Biomedal Company.

[0033] In the first step, the polycloning restriction site is inserted. Synthesize the polyclonal enzyme cutting site sequence first, and the enzyme cutting sites are as follows: Speech I. Pst I. xho I. Bgl II. Xba I, Sal I, Nhe I. Apa I and Sph I, Fragment 1: 5'- CTAGT GCTTACCG CTGCAG AGTCATTCT CTCGAG CTCAGA TCTAGA GTC GAC GCTA...

Embodiment 2

[0039] Example 2: Construction of Riemerella anatipestifer using the Riemerella anatipestifer-Escherichia coli shuttle expression vector dhdps Complementary strains of genetic mutants

[0040] Riemerella anatipestifer serotype 1 CH 3 The strain has a strong ability to form biofilms. Studying the genes related to biofilm formation is helpful for analyzing the biological functions of Riemerella anatipestifer biofilms and the molecular mechanism of biofilm formation, and finding ways to inhibit the biofilm formation of Riemerella anatipestifer. It is very important to form and destroy or remove the biofilm that has formed. The applicant of this patent has constructed Riemerella anatipestifer CH by using transposon random mutation technology 3 The random mutation library of strains, screened some genes that may be related to its biofilm formation, among which dhdps gene insertion mutant CH 3 △ dhdps Biofilm formation almost completely disappeared. for further dhdp...

Embodiment 3

[0047] Example 3: Using the Riemerella anatipestifer-Escherichia coli shuttle expression vector to construct a recombinant Riemerella anatipestifer expressing duck-pathogenic Escherichia coli OmpA protein

[0048] The foreign gene carried by the Riemerella anatipestifer-Escherichia coli shuttle expression vector can be stably expressed in the Riemerella anatipestifer, so the recombinant Riemerella anatipestifer expressing the foreign gene can be constructed.

[0049] The build steps are as follows:

[0050] (1) Expansion of Escherichia coli ompA Gene ORF (Open Reading Frame): Amplified from O1 serotype duck pathogenic Escherichia coli strain WX strain by PCR method ompA Gene.

[0051] The forward primer used is: 5'-TA CTGCAG GTGAAGGATTTAACCGTGTTATCTC -3' , 5' added Pst I restriction site; reverse primer: 5'-TC TCTAGA TTAAGCCTGCGGCTGAGTTACAAC-3', 5' end added Xba I restriction site. The PCR amplification conditions were: denaturation at 95°C for 5 minutes, 25 cyc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and particularly relates to a riemerella anatipestifer-escherichia coli shuttle expression vector as well as a construction method and an application thereof. The riemerella anatipestifer-escherichia coli shuttle expression vector disclosed by the invention has a nucleotide sequence of SEQ ID NO:1. The invention further discloses a construction method and the application of the riemerella anatipestifer-escherichia coli shuttle expression vector. The riemerella anatipestifer-escherichia coli shuttle expression vector pRES constructed by the construction method can stably exist and can be copied in riemerella anatipestifer and escherichia coli; an exogenous gene carried by the riemerella anatipestifer-escherichia coli shuttle expression vector can be stably expressed in the riemerella anatipestifer; the riemerella anatipestifer-escherichia coli shuttle expression vector can be used for complementary assay of riemerella anatipestifer deletion mutation strains, research of recombinant riemerella anatipestifer vaccines and the like and has a wide application prospect.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, the invention relates to a Riemerella anatipestifer-Escherichia coli shuttle expression vector and its construction method and application. Background technique [0002] Riemerella anatipestifer is a representative species of the genus Riemerella in the family Flavobacteriaceae. The genus Riemerella is a newly independent genus, and the current research on the plasmid of Riemerella anatipestifer is limited to detection and sequence determination. For example, Chang et al. studied the strains of Riemerella anatipestifer isolated from Taiwan and showed that 60% (36 / 60) of the strains carried a 3.9 kb plasmid; 12% (7 / 60) of the strains carried a 6.5 kb and 16 kb of two plasmids; 5% (3 / 60) of the strains carried three plasmids of 2.9kb, 16kb and 18 kb, and the other 13% of the strains had no plasmid. And published the full sequence of 3.9 kb plasmid pCFC1 on GenBank. Weng S et al publis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/74C12N1/21C12N15/64
Inventor胡青海于圣青韩先干丁铲仇旭升宋翠萍谭磊
OwnerSHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI