Riemerella anatipestifer-escherichia coli shuttle expression vector as well as construction method and application thereof
A shuttle expression vector, technology of Riemer's anatipestifer, applied in the field of Riemerella anatipestifer-Escherichia coli shuttle expression vector and its construction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Construction of Riemerella anatipestifer-Escherichia coli shuttle expression vector
[0032] Described Riemerella anatipestifer is any Riemerella anatipestifer bacterial strain, the Riemerella anatipestifer CH used in this example 3 strain and YXL3 strain were isolated and identified from domestic diseased duck heart blood and liver by the inventor (both serotype 1); the Escherichia coli is an engineering strain of Escherichia coli, such as S 17-1 λpir, CC118 λpir, SM10 λpir and DH5a λpir etc., the Escherichia coli S 17-1 λpir strain used in this example was purchased from Spain Biomedal Company.
[0033] In the first step, the polycloning restriction site is inserted. Synthesize the polyclonal enzyme cutting site sequence first, and the enzyme cutting sites are as follows: Speech I. Pst I. xho I. Bgl II. Xba I, Sal I, Nhe I. Apa I and Sph I, Fragment 1: 5'- CTAGT GCTTACCG CTGCAG AGTCATTCT CTCGAG CTCAGA TCTAGA GTC GAC GCTA...
Embodiment 2
[0039] Example 2: Construction of Riemerella anatipestifer using the Riemerella anatipestifer-Escherichia coli shuttle expression vector dhdps Complementary strains of genetic mutants
[0040] Riemerella anatipestifer serotype 1 CH 3 The strain has a strong ability to form biofilms. Studying the genes related to biofilm formation is helpful for analyzing the biological functions of Riemerella anatipestifer biofilms and the molecular mechanism of biofilm formation, and finding ways to inhibit the biofilm formation of Riemerella anatipestifer. It is very important to form and destroy or remove the biofilm that has formed. The applicant of this patent has constructed Riemerella anatipestifer CH by using transposon random mutation technology 3 The random mutation library of strains, screened some genes that may be related to its biofilm formation, among which dhdps gene insertion mutant CH 3 △ dhdps Biofilm formation almost completely disappeared. for further dhdp...
Embodiment 3
[0047] Example 3: Using the Riemerella anatipestifer-Escherichia coli shuttle expression vector to construct a recombinant Riemerella anatipestifer expressing duck-pathogenic Escherichia coli OmpA protein
[0048] The foreign gene carried by the Riemerella anatipestifer-Escherichia coli shuttle expression vector can be stably expressed in the Riemerella anatipestifer, so the recombinant Riemerella anatipestifer expressing the foreign gene can be constructed.
[0049] The build steps are as follows:
[0050] (1) Expansion of Escherichia coli ompA Gene ORF (Open Reading Frame): Amplified from O1 serotype duck pathogenic Escherichia coli strain WX strain by PCR method ompA Gene.
[0051] The forward primer used is: 5'-TA CTGCAG GTGAAGGATTTAACCGTGTTATCTC -3' , 5' added Pst I restriction site; reverse primer: 5'-TC TCTAGA TTAAGCCTGCGGCTGAGTTACAAC-3', 5' end added Xba I restriction site. The PCR amplification conditions were: denaturation at 95°C for 5 minutes, 25 cyc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 