Unlock instant, AI-driven research and patent intelligence for your innovation.

Transgenic wheat quantitative determination single-copy RPL21 internal standard primer and application

A technology of transgenic and internal standard gene, which is applied in the field of quantitative detection of single-copy RPL21 internal standard primers and applications in transgenic wheat, which can solve the problems of increased detection limit value

Inactive Publication Date: 2013-10-30
HUAZHONG AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0017] 3. The copy number in the genome is determined and low
In addition, some plant species (such as wheat) have a large genome (contains a large amount of chromosomal DNA, C=17.33pg), relatively speaking, only a small proportion of exogenous gene DNA participates in the PCR reaction, so the limit value of detection increases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic wheat quantitative determination single-copy RPL21 internal standard primer and application
  • Transgenic wheat quantitative determination single-copy RPL21 internal standard primer and application
  • Transgenic wheat quantitative determination single-copy RPL21 internal standard primer and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0138] A preparation method for standard gene primers in wheat detection, the steps are:

[0139] 1. Screen the genes with good species specificity, and design primers with non-homologous segments at the same time, non-homologous segments (see figure 1 ). Use this as a template to design primers. The amplified segments are as follows, and the upstream and downstream sequences are subjected to Primer-Blast (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / #)

[0140] Set comparison parameters respectively, specific species: Poales; database: nr (see figure 2 ).

[0141] 901 ATGTAATGTT GCATATGGGT TGCATATCCT AGCCCGTTTCATCTAATGTG TCCTAGTTTG

[0142] 961 GATGCATTTC ATGGCTTGTT TTGTCTAATA TGTAGTAGTTTGGATGCATT TCATGGCTCA

[0143] 1021 TCTTTGTATG CTGATAAGAT TTTTGTACAC GGTAAGTGTTAGCTCTCTAA TGGTTCTCGT

[0144] 1081 TGGTAGTAGT TGTTTGTTTT ATCCATTTGG ATTGGTAGACCACAGTAAGC CACATTTTAC

[0145] 2. Experimental materials (purchased from the farmers market of Huazhong Agricultural Universit...

Embodiment 2

[0178] A kind of application of internal standard gene primer (RPL21-7 / RPL21-8) in the quantitative qPCR quantitative detection of hexaploid wheat genome DNA, its steps are:

[0179] 1. Southern Blot identification of copy number

[0180] Probe preparation:

[0181]

[0182] Isotope labeling of the probes was performed using Takara's Random Primer Labeling Kit.

[0183] The marking steps are as follows:

[0184] 1) Add 100ng of probe DNA and 2μl of random primers into a 1.5ml centrifuge tube; and add water to 14μl.

[0185] 2) Boil in boiling water for 5 minutes, cool in an ice-water bath for 5 minutes, and centrifuge.

[0186] 3) Add 2.5 μl 10×Buffer, 2.5 μl dNTP, 5 μl α-[32P]-dCTP.

[0187] 4) Add 1ul DNA polymerase. 37°C water bath for 30min.

[0188] 5) Add 1.6ul of 0.5MEDTA to terminate the reaction.

[0189] 6) Boil in boiling water for 5 minutes, cool in an ice-water bath for 10 minutes, and centrifuge.

[0190] Digestion and electrophoresis:

[0191] Take a...

Embodiment 3

[0295] An application of an internal standard gene primer (RPL21-7 / RPL21-8) in the quantitative detection of wheat transgenes in the identification of copy number and the calculation of transgenic components, the steps are:

[0296] 1. For the quantitative detection of transgenic wheat wheat seed DNA extraction:

[0297] 1) Preparation of experimental reagents

[0298] Extraction Buffer: 50mM Tris-HCl PH 9.0: 200mM NaCl; 1% Sarkosyl (m / v): 20mM EDTA; 5mM DTT), 121°C for 35min:

[0299] 2) The offspring seeds of CK (Y11) and T (transgenic line R4) were provided by Dr. Gao Chunsheng in the laboratory and placed at 28. ℃ oven for 3 days, grind into a uniform powder with a grinder, and mix by weighing different weights;

[0300]

[0301] 3) Add the weighed wheat powder to 15ml Extraction Buffer, and shake vigorously for 5 minutes with a vortex instrument;

[0302] 4) Add an equal volume of 15ml pre-cooled PCI, shake vigorously, 12,000rpm for 10min;

[0303] 5) Take 13ml of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transgenic wheat quantitative determination single-copy RPL21 internal standard primer and an application. A preparation method of the primer is as follows: A, screening structural genes through different databases, designing a primer by a nonhomologous section, detecting the species specificity of the designed primer by a Primer-Blast bioinformatic tool in an NCBI, and verifying the products of the primer in different databases; and B, sterilizing, disinfecting and germinating 35 different wheat varieties and 15 different species seeds, taking leaves for DNA extraction by a CTAB method, verifying species specificity in different species and intervarietal stability in different wheat varieties by common quantitative PCR. The internal standard gene primer sequence has a name of Accession and a binding site sequence of 5'-3' Size Ta DEG C; RPL21-7 HM138481.1928-955 For: CCTAGCCCGTTTCATCTAATGTGTCCTA 161 60; RPL21-8 1088-1062 Rev: TACTACCAACGAGAACCATTAGAGAGC. By comparing with a Southern Blot result, accurate quantitation of copy number can be realized, the transgenic wheat qualitative detection limit is 0.2%, the transgenic wheat quantitative detection limit threshold is 2% and the copy number is 5 sextuploid wheat genomes, which are consistent with those of predicated wheat theory detection limit.

Description

technical field [0001] The invention belongs to the field of genetically modified detection of Triticum genus crops, food, and deep-processed products in plant inspection and quarantine, uses qPCR to design internal standard gene primers based on the RPL21 (Ta RPL21gene, HM138481.1) gene for quantitative detection of wheat genetically modified genes, and uses internal standard gene primers Species specificity, intra-species stability, and low copy number are verified by bioinformatics prediction, common PCR, quantitative qPCR, Southern, and sequencing Clustal analysis, which proves that it does have excellent species specificity and stable inter-species stability , the copy number is 1, the mapping site is 3, it is derived from the A genome, and the amplified region is unique and located in the A genome. It is specifically applied to the quantification of endogenous genes in transgenic detection, as an internal standard gene to quantitatively detect the number of insertion sit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/10C12N15/11
Inventor 廖玉才李和平赵正喜高春生瞿波黄涛张静柏左东云杨鹏程伟
Owner HUAZHONG AGRI UNIV