Application of OsHSF08 gene in controlling rice drought resistance

A drought resistance, genetic technology, applied in application, genetic engineering, plant genetic improvement and other directions

Inactive Publication Date: 2013-12-04
HUAZHONG AGRI UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In view of whether heat shock transcription factors in rice can improve the stress resistance of rice, there is no relevant report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsHSF08 gene in controlling rice drought resistance
  • Application of OsHSF08 gene in controlling rice drought resistance
  • Application of OsHSF08 gene in controlling rice drought resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Isolation of OsHSF08T-DNA insertion mutants

[0026] From the rice mutant library RMD (the starting material of the present invention is the mutant 03Z11CE69 retrieval address: http: / / rmd.ncpgr.cn / search.cgi, managed by the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University). The T-DNA insertion mutant 03Z11CE69 corresponding to the gene site induced by stress-induced increase, wherein the flanking sequence of the OsHSF08T-DNA mutant 03Z11CE69 (the sequence length is 847bp):

[0027] TCTTTGTGTTTGCAATTTGCAGGGTTTCAGAAAGATTGATCCTGACAGATGGGAATTCGCGAATGATGGTTTCCTGAGAGGCCAGAGGCATCTTCTAAAGATGATTAAGAGGAGGAGACCATTGTCTTATCTCCCTGGATCTCAGCAGGCACTTGGCACCTGCCTTGAGGTTGGTCAGTTCGGATTAGATGAAGAGATCGACAGGCTAAAGCGTGACAAGAACATCTTACTCGCGGAGGTTGTGAAACTAAGGCACAAGCAGCAAAGCACGAAAGCCAATATGCGAGCCATGGAAGAGAGGCTGCAACATGCGGAGCAGAAGCAGGTCCAGATGATGGGTTTCTTGGCAAGAGCAATGCAGAACCCTGACTTCTTTCACCAGTTGATTCACCAGCAGGATAAAATGAAGGGGCTCGAGGACACATTCTCGAAGAAGAGGACGAGGTCGATAGA...

Embodiment 2

[0030] Embodiment 2: Detection of the expression level of rice endogenous OsHSF08 gene

[0031] We selected the japonica rice variety "Zhonghua 11" (abbreviated as ZH11, Institute of Crop Science, Chinese Academy of Agricultural Sciences, a rice variety publicly promoted and applied) as the material for expression profile analysis. After seed germination, various abiotic stresses and hormone treatments were carried out when the seeds were grown to the four-leaf stage in normal soil in small buckets. Drought treatment is to let it dry naturally without watering, and samples are taken before the stress, 1 day, 2 days, and 3 days after the stress, and 1 day after rehydration; low temperature stress is to put the four-leaf stage rice seedlings into artificial climate at 4 °C In the chamber, samples were taken before stress and 1.5 hours, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, and 48 hours after stress. For hormone treatment, 200 μM abscisic acid (ABA) was evenly sprayed...

Embodiment 3

[0033] Example 3: Identification of OsHSF08 mutant phenotype observations under normal growth conditions

[0034] In order to study the function of OsHSF08 gene, we planted three independent homozygous families of OsHSF08 mutants OsHSF08-M1, OsHSF08-M2, OsHSF08-M3 and three independent negative families OsHSF08-N1, OsHSF08-N2, OsHSF08-N3, measure their tiller angle and flag leaf angle at the heading stage. The tiller angle is the angle between the effective tiller and the vertical direction. Each individual plant is measured and compared to the four outer tillers. Each 10 individual plants were tested in the family. According to the measurement statistics, it was found that the tiller angle of the OsHSF08 homozygous mutant was about 45 degrees, while the tiller angle of the negative control family was about 28 degrees, which was significantly lower than that of the homozygous mutant ( Figure 4 A). The angle between the flag leaves at the heading stage is measured by selecti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of rice genetic engineering, and in particular relates to gene OsHSF08 capable of remarkably increasing drought resistance during seeding stage and booting stage, which is obtained through screening, separating, cloning and functional verification. The gene OsHSF08 capable of controlling rice drought resistance character is obtained through cloning by screening insertion of T-DNA into rice mutant library, and has nucleotide sequence shown in SEQ ID No: 1; and the coded protein has nucleotide sequence shown in SEQ ID No: 2. Coseparation detection shows that the mutant is tightly linked with drought sensitivity phenotype, and the over-expression of OsHSF08 gene in rice can remarkably increase the drought resistance of the genetically modified rice, so that new function and new application approach of the gene are proven.

Description

technical field [0001] The invention relates to the field of rice genetic engineering. It specifically involves screening, isolation, cloning and functional verification to obtain a gene OsHSF08 that can significantly improve the drought tolerance of rice at the seedling and booting stages, and the application of the gene in the genetic improvement of rice drought resistance. The present invention adopts the method of screening T-DNA inserted into the rice mutant library, and clones the gene OsHSF08 controlling drought-resistant traits of rice. Co-segregation detection shows that the mutant is closely linked with the drought-sensitive phenotype, and the OsHSF08 gene is overexpressed in rice. , can significantly improve the ability of transgenic rice to resist drought, and we have confirmed the function and application of the gene. Background technique [0002] Plants provide energy for heterotrophic organisms on the earth, stabilize the content of CO2 and O2 in the air, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/89C12N15/87C12N15/83C12N15/84A01H5/00
Inventor熊立仲都浩
OwnerHUAZHONG AGRI UNIV