Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker tightly interlocked with major gene locus of wheat spikelet number as well as obtaining method and application of molecular marker

A technology of molecular markers and major genes, which is applied in biochemical equipment and methods, microbial measurement/inspection, DNA preparation, etc., to achieve the effects of improving selection efficiency and quality, speeding up the selection process, and saving production costs

Inactive Publication Date: 2013-12-18
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For decades, in terms of improving wheat yield, great progress has been made in improving wheat yield by increasing the number of spikes and thousand-grain weight, and it is difficult to make further breakthroughs at present; however, the yield potential can still be increased by increasing the number of spikes (He Zhonghu et al., Crops Journal, 2011, 37: 202-215)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker tightly interlocked with major gene locus of wheat spikelet number as well as obtaining method and application of molecular marker
  • Molecular marker tightly interlocked with major gene locus of wheat spikelet number as well as obtaining method and application of molecular marker
  • Molecular marker tightly interlocked with major gene locus of wheat spikelet number as well as obtaining method and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] A molecular marker closely linked to the main effect gene locus of spikelet number in wheat,

[0036] labeled primers Xbarc192 ,

[0037] The left end primer sequence GCGAATAGCACTATGGTAAACATTGAGGTAC (as described in SEQ ID NO: 1)

[0038] Right end primer sequence GCGGGTTCAATTATCAAAAGGCACAG (as described in SEQ ID NO: 2)

[0039] and labeled primers Xbarc253 ,

[0040] Left end primer sequence GGGAAGACACGACACGACTC (as described in SEQ ID NO:3)

[0041] Right end primer sequence TCGTAAGATTACCTCGGATGAAGAA (as described in SEQ ID NO:4)

[0042] The DNA of wheat variety Jing 411 was amplified by PCR respectively. The PCR amplification system was 20 μl, including: 1.0 μl each of the left and right primers (10 μmol / L), 10×Buffer 2.0 μl, Mg 2+ (25 mmol / L) 1.2 μl, Taq enzyme (5 U / μl) 0.2 μl, dNTP (2.5 mmol / L) 0.6 μl, DNA (30 ng / μl) 2.0 μl, and ddH for the rest 2 O supplementation; PCR amplification program: pre-denaturation at 94°C for 7 min; denaturation at 94°C for 30...

Embodiment 2

[0056] The main effect gene loci with wheat spikelet number provided by the present invention QTss.cas-7A Application of tightly linked molecular markers in 10 derived lines of wheat variety Jing 411 and wheat variety Xiaoyan 54.

[0057] Using Xiaoyan 54 as the female parent and Jing 411 as the male parent, the F 7 Recombinant inbred line populations (RIL populations). labeled primers Xbarc192 and Xbarc253 Jing 411, Xiaoyan 54 and 10 derivative lines were analyzed. The specific steps are as follows:

[0058] (1) The wheat varieties Jing 411, Xiaoyan 54 and 10 derived lines were planted in the field, and the leaves of the plants of each line were separated and extracted by the SDS method;

[0059] The derivative strain of the wheat variety Jing 411 refers to a strain obtained by using Xiaoyan 54 as the female parent and Jing 411 as the male parent through the single-seed propagation method;

[0060] (2) Using labeled primers Xbarc192 and Xbarc253 The obtained DNA wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker tightly interlocked with a major gene locus of a wheat spikelet number. DNA (Deoxyribose Nucleic Acid) of a wheat variety Jing411 is subjected to PCR (Polymerase Chain Reaction) amplification by adopting labeled primers Xbarc192 and Xbarc253, amplification products are subjected to electrophoretic separation on 8 percent polyacrylamide gel, and the molecular weight of the obtained amplification products are respectively 200bp and 186bp, namely, the molecular marker of the major gene locus QTss.cas-7A of the wheat spikelet number. The molecular marker of the major gene locus of the wheat spikelet number, provided by the invention, can be used for detecting whether the major gene locus QTss.cas-7A for increasing the wheat spikelet number is contained in the wheat variety or strain so that the wheat variety or strain with the gene locus is rapidly screened for breeding, and thus the breeding progress of the wheat high-yield variety can be greatly increased.

Description

technical field [0001] The invention relates to the application field of wheat molecular biotechnology and breeding, in particular to a molecular marker closely linked to a main gene locus for increasing the number of wheat spikelets and its acquisition method and application. Background technique [0002] Wheat is one of the most important food crops in the world and the second largest food crop in my country. Its high and stable yield directly affects people's living standards and national food security in our country. Improving wheat yield per unit area and cultivating high-yielding new varieties are the fundamental way out to ensure my country's total wheat production level and ensure food security. Wheat yield traits are complex quantitative traits controlled by multiple quantitative trait loci (Quantitative trait loci, QTL). , Traditional breeding methods often have the problems of long time, large consumption, high cost and small results. Molecular marker-assisted b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor 安调过许云峰王瑞芳童依平刘冬成张爱民李滨
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More