Susceptible noninvasive detection kit for hypertension (genes like GNB3)
A high blood pressure, kit technology, applied in the field of molecular biology, can solve problems such as increasing the risk of hypertension
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0020] Example 1. Use of detection kits.
[0021] 1. Extract DNA template
[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0023] 2. PCR amplification reaction
[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0025] (1) GNB3 (C825T) forward primer: 5'TTCCTGCCGCTTGTTTGA3'
[0026] GNB3 (C825T) reverse primer: 5'AAATGCCAGGAACCCAGAA3'
[0027] (2) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'
[0028] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'
[0029] (3) TGF-Β1 (T869C) forward primer: 5'TTTCCGTGGGATACTGAGACA3'
[0030] TGF-Β1 (T869C) reverse primer: 5'GCTTCCGCTTCACCAGCT3'.
[0031] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ul; 25mM dNTP mixture 0.2ul, 5U / ul Taq enzyme 0.125ul, DNA template 1ul (about 12-15ng), 20uM forward primer and reverse primer Each 0.25ul, ...
Embodiment 2
[0046] Example 2. The service of non-invasive detection of genes for the prevention of hypertension for the population.
[0047] 1. Sampling and DNA extraction
[0048] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.
[0049] 2. Genotype detection
[0050] Using the kit provided by the present invention, three single nucleotide polymorphisms of C825T (rs5443) on the GNB3 gene, C677T (rs1801133) on the MTHFR gene, and T869C (rs1982073) on the TGF-B1 gene of the subject's genomic DNA The loci were subjected to DNA sequencing to determine the genotypes of the three SNPs loci.
[0051] 3. Risk assessment and analysis of high-risk groups with hypertension
[0052] Through the analysis of the SNPs genotype of the subjects, a hypertension risk assessment analysis report is issued. The report details the genetic t...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap