Protein IbTPS (Ipomoea batatas trehalose-6-phosphate synthase) related to salt resistance of sweet potato as well as encoding gene and application of protein
A protein and coding technology, applied in sweet potato salt tolerance-related protein IbTPS and its coding gene and application field, can solve problems restricting agricultural crop production, etc., and achieve the effect of broad application space and market prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Embodiment 1, the acquisition of protein IbTPS and its coding gene associated with sweet potato salt tolerance
[0048] 1. Acquisition of salt-tolerance-related protein IbTPS and its coding gene
[0049] Experimental material: sweet potato variety Lushu No. 3 (the public can obtain it from China Agricultural University, and the non-patent literature that has recorded this material is: Zhai Hong, Shang Lili, Liu Qingchang. The construction of the cDNA library of sweet potato D. Analysis of expressed sequence tags. Journal of Agricultural Biotechnology, 2010, 18 (1): 141–148) The expanded leaves of sterile seedlings were removed, quick-frozen in liquid nitrogen, and stored at -80°C.
[0050] 1. Extraction and purification of total RNA from leaves
[0051] Take about 2 g of the expanded leaves of aseptic seedling Lushu No. 3, grind them into powder in liquid nitrogen, add them to a 10mL centrifuge tube, and use the Applygen Plant RNA Extraction Kit (Applygen Technologies In...
Embodiment 2
[0075] Embodiment 2, the application of IbTPS protein in improving plant salt tolerance
[0076] 1. Acquisition of trans IbTPS tobacco
[0077] 1. Construction of recombinant vector pCBIbTPS
[0078] According to the coding sequence of the sweet potato IbTPS protein cDNA, the primer sequences for amplifying the complete coding sequence were designed, and the forward and reverse primers were respectively introduced into BamH I and Sac I restriction sites, and the primer sequences were as follows:
[0079] Primer 11: 5'G GGATCC ATGGTGTCGAGATCATATTCAA' (sequence 5) (the underlined part is the BamH I restriction site),
[0080] Primer 12: 5'TC GAGCTC TTATAGAAGGGCTGTTTGTTGTT3' (SEQ ID NO: 6) (the underlined part is the Sac I restriction site).
[0081] Using the DNA molecule shown in sequence 1 in the artificially synthesized sequence listing as a template (or using Lushu No. 3 cDNA as a template), carry out PCR amplification with primer 11 and primer 12 to obtain a 2595bp ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 