Cancer suppressor gene ATOH8 and application of encoding protein thereof

A gene and coding technology, which is applied in the application field of tumor suppressor gene ATOH8 and its encoded protein, can solve the problem that the surface markers of tumor stem cells are poorly understood.

Active Publication Date: 2014-04-23
SUN YAT SEN UNIV CANCER CENT
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Even so, little is known about cancer stem cell surface markers to date

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cancer suppressor gene ATOH8 and application of encoding protein thereof
  • Cancer suppressor gene ATOH8 and application of encoding protein thereof
  • Cancer suppressor gene ATOH8 and application of encoding protein thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 ATOH8 is down-regulated in liver cancer tissue

[0028] 1. RNA-seq high-throughput sequencing

[0029] By extracting the RNA of 3 pairs of liver cancer patients' cancer tissues and their corresponding paracancerous tissues for high-throughput sequencing, it was found that ATOH8 was all lowly expressed in the cancer tissues of the 3 pairs of patients. The result is as figure 1 As shown: 448N(41) indicates that the reading of 448 samples of paracancerous tissue is 41; 448T(1) indicates that the reading of 448 samples of cancer tissue is 1; 473N(29) indicates that the reading of 473 samples of cancer tissue is 1; 473T(3) means that the reading of 473 samples of cancer tissue in the sample is 3; 510N(39) means that the reading of 510 samples of adjacent tissue is 39 ; 510T(3) indicates that the reading of 510 sample cancer tissues in the sample is 3.

[0030] 2. qRT-PCR detection of the expression of ATOH8 in clinical specimens of liver cancer patients

[0031...

Embodiment 2

[0040] Example 2 The Inhibitory Effect of ATOH8 on Stem Cell Pluripotency Gene

[0041] 1. Construction of a stable ATOH8 overexpressed cell line

[0042] Liver cancer cell lines Huh7 (Hokkaido University, Japan) and PLC8024 (Wuhan Institute of Virology, Chinese Academy of Sciences) were cultured in DMEM medium (DMEM; Gibco BRL) supplemented with 10% fetal bovine serum (Gibco BRL) in a carbon dioxide incubator at 37°C .

[0043] ① Construct the expression plasmid of ATOH8

[0044] The full-length cDNA sequence of ATOH8 was amplified by PCR, and the primer sequences were as follows:

[0045] F: CGCAAATGGGCGGTAGGCGTG (SEQ ID NO. 1);

[0046] R: ACCGAGGAGAGGGTTAGGGAT (SEQ ID NO. 2).

[0047] Construct the purified ATOH8 full-length sequence into pLenti6 / V5- On the expression vector (Invitrogen, K4950-00), the ATOH8 expression plasmid pLenti6-ATOH8 was obtained.

[0048] ② Transfection of liver cancer cells

[0049] The obtained pLenti6-ATOH8 and the pLenti6 empty vector (p...

Embodiment 3A

[0072] Example 3 ATOH8 inhibits the growth, migration and metastasis of liver cancer cells

[0073] In this example, the cells used in the experimental group were PLC8024 and Huh7 cell lines (8024-ATOH8, Huh7-ATOH8) overexpressing ATOH8 treated with pLenti6-ATOH8 as described in Example 2, and the cells used in the control group were blank vector pLenti6-vector Processed PLC8024 and Huh7 cell lines (8024-Vec, Huh7-Vec).

[0074] 1. Cell growth experiment

[0075] Changes in the growth rate of cells overexpressing ATOH8 were detected by the content of XTT. The experimental operation was carried out according to the instructions of the cell proliferation XTT kit (Roche, Mannheim). The brief description is as follows: Cells in the experimental group or control group were divided into 1×10 4 Cells / well were inoculated in 24-well culture plates, and XTT labeling mixture with a final concentration of 100 μl of 0.3 mg / mL was added to a group of cells every 24 hours, and the OD val...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a cancer suppressor gene ATOH8 and application of an encoding protein thereof. A novel cancer suppressor gene ATOH8 is found. As proved by in-vivo and in-vitro functional study analysis, the cancer suppressor gene plays an important role in the incidence and development processes of cancers. By using the ATOH8, stem cell differentiation can be facilitated, and the drug tolerance of cancer stem cells to chemotherapeutic medicaments can be lowered. Moreover, a novel effective way is provided for induction of the formation of iPSCs (induced Pluripotent Stem Cells) by means of expression of silent ATOH8. By using the cancer suppressor gene ATOH8, novel diagnosis and treatment methods and a medicament screening platform are provided for neoplastic diseases.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the application of a new tumor suppressor gene and its encoded protein, in particular to the application of the tumor suppressor gene ATOH8 and its encoded protein. Background technique [0002] Hepatocellular carcinoma is the fifth most common cancer in the world, affecting millions of lives every year. Surgical methods bring hope for the long-term survival of liver cancer patients, but they are only suitable for a small number of patients with indications. Liver cancer is usually diagnosed at an advanced stage and has metastasized and spread. For most liver cancer patients, the survival rate is only about 6 months or so. For patients with nonsurgical indications, chemotherapy is the mainstay of treatment. The average survival rate of liver cancer patients with chemotherapy is only 4 months. Therefore, there is an urgent need to develop more reliable biomarker diagnostic methods, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K38/17A61P35/00C12N5/095C12Q1/68G01N33/574
CPCC12N5/0695C12N2506/30
Inventor 关新元宋洋洋李焱
Owner SUN YAT SEN UNIV CANCER CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap