A pair of sgRNAs targeting the sheep DKK2 gene
A DNA molecule and sheep technology, applied in the field of genetic engineering, can solve problems such as increased hair follicle density, reduced hair follicle spacing, and reduced DKK2 expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1, the construction of sgRNA expression plasmid pair
[0020] 1. sgRNA target design
[0021] The coding region of the first exon of the sheep DKK2 gene (18259978-18260199, as shown below) was extracted from the sequence of NCBI GI: 417531944, and the target site was designed (http: / / zifit.partners.org / ZiFiT).
[0022]
[0023] The forward target sequence is GCTCACAGTTCGGCAGCTCG (74-93) and the reverse target sequence is GCTCTCCACCATCAGCACCG (56-75). The two target sequences are arranged in a "head-to-head" manner, and the distance between the two is -2bp, that is, there is a 2bp overlap. Name them as forward target T1 and reverse target T2 respectively.
[0024] 2. Construction of sgRNA expression plasmid pair
[0025] First, according to the designed target sequence, send it to Beijing Liuhe Huada Gene Technology Co., Ltd. to synthesize single-stranded oligonucleotides. The specific sequence is as follows:
[0026] T1-F: CACCGCTCACAGTTCGGCAGCTCG
[...
Embodiment 2
[0031]Example 2. Verifying the biological activity of the sgRNA expression plasmid pair constructed in Example 1 by sequencing
[0032] Sheep Fetal Fibroblasts (SEF): For isolation and culture methods, please refer to the literature: Meng Fanhua, Xiao Hongmei, Zhang Dong, Zhou Huanmin. Isolation, culture and characteristic analysis of Mongolian sheep fetal skin fibroblasts. "China Animal Husbandry and Veterinary Medicine" 2012 No. 3, 136- 140.
[0033] 1. Co-transfect 4 μg of each of the recombinant plasmids pX335-sgRNA-F and pX335-sgRNA-R into 1×10 6 SEF cells to obtain recombinant cells. The specific steps of transfection are as follows: use a nuclear transfer instrument (Amaxa, model: AAD-1001S) and a matching mammalian fibroblast transfection kit (Amaxa, product number: VPI-1002) for transfection. First, digest adherent cells with 0.05% trypsin (Gibco, catalog number: 610-5300AG), stop digestion with fetal bovine serum (Gibco, catalog number: 16000-044), and wash with ph...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 