Unlock instant, AI-driven research and patent intelligence for your innovation.

A pair of sgRNAs targeting the sheep DKK2 gene

A DNA molecule and sheep technology, applied in the field of genetic engineering, can solve problems such as increased hair follicle density, reduced hair follicle spacing, and reduced DKK2 expression

Inactive Publication Date: 2016-11-30
QINGDAO AGRI UNIV +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Sick et al. used the reaction-diffusion model to predict that the decrease in the expression of DKK or the acceleration of degradation would lead to a decrease in hair follicle spacing (Wnt and dkk determine hair follicle spacing through a reaction-diffusion mechanism.Science.Sick et al, 2006)
Consistent with this prediction, inhibition of BMP signaling leads to increased hair follicle density (Making waves with hairs. J Invest Dermatol. Plikus et al, 2004), whereas inhibition of BMP may reduce DKK2 expression (The Wnt antagonist Dickkopf-1 is regulated by Bmp signaling and c-Jun and modulates programmed cell death. EMBO J. Grotewold et al, 2002)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A pair of sgRNAs targeting the sheep DKK2 gene
  • A pair of sgRNAs targeting the sheep DKK2 gene
  • A pair of sgRNAs targeting the sheep DKK2 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1, the construction of sgRNA expression plasmid pair

[0020] 1. sgRNA target design

[0021] The coding region of the first exon of the sheep DKK2 gene (18259978-18260199, as shown below) was extracted from the sequence of NCBI GI: 417531944, and the target site was designed (http: / / zifit.partners.org / ZiFiT).

[0022]

[0023] The forward target sequence is GCTCACAGTTCGGCAGCTCG (74-93) and the reverse target sequence is GCTCTCCACCATCAGCACCG (56-75). The two target sequences are arranged in a "head-to-head" manner, and the distance between the two is -2bp, that is, there is a 2bp overlap. Name them as forward target T1 and reverse target T2 respectively.

[0024] 2. Construction of sgRNA expression plasmid pair

[0025] First, according to the designed target sequence, send it to Beijing Liuhe Huada Gene Technology Co., Ltd. to synthesize single-stranded oligonucleotides. The specific sequence is as follows:

[0026] T1-F: CACCGCTCACAGTTCGGCAGCTCG

[...

Embodiment 2

[0031]Example 2. Verifying the biological activity of the sgRNA expression plasmid pair constructed in Example 1 by sequencing

[0032] Sheep Fetal Fibroblasts (SEF): For isolation and culture methods, please refer to the literature: Meng Fanhua, Xiao Hongmei, Zhang Dong, Zhou Huanmin. Isolation, culture and characteristic analysis of Mongolian sheep fetal skin fibroblasts. "China Animal Husbandry and Veterinary Medicine" 2012 No. 3, 136- 140.

[0033] 1. Co-transfect 4 μg of each of the recombinant plasmids pX335-sgRNA-F and pX335-sgRNA-R into 1×10 6 SEF cells to obtain recombinant cells. The specific steps of transfection are as follows: use a nuclear transfer instrument (Amaxa, model: AAD-1001S) and a matching mammalian fibroblast transfection kit (Amaxa, product number: VPI-1002) for transfection. First, digest adherent cells with 0.05% trypsin (Gibco, catalog number: 610-5300AG), stop digestion with fetal bovine serum (Gibco, catalog number: 16000-044), and wash with ph...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pair of sgRNA targeting sheep DKK2 gene, the sgRNA pair is composed of sgRNA-F and sgRNA-R, and the sgRNA-F and sgRNA-R are respectively composed of 101 nucleotides, wherein the 20nt RNA at the 5' end The fragment can recognize the DKK2 gene on the sheep chromosome, and the remaining 81nt RNA fragment is a backbone RNA fragment capable of binding to Cas9n nuclease; the sgRNA-F is shown in sequence 2 of the sequence listing, and the sgRNA-R is shown in the sequence listing Sequence 4 of The invention uses the Cas9 system to knock out or modify the sheep DKK2 gene at the cell or individual level to analyze the function of the sheep DKK2 gene, construct a sheep DKK2 gene mutation library, and serve sheep breeding.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a pair of sgRNA targeting and recognizing sheep DKK2 gene and application thereof. Background technique [0002] ZFN and TALEN targeting technologies are two relatively mature site-directed mutagenesis technologies, but the construction procedures of these two technologies are relatively cumbersome, and a pair of corresponding nucleases needs to be constructed for each site. The CRISPR / Cas9 system’s recognition of specific sites is guided by small crRNAs. The CRISPR region can be composed of a series of crRNAs. Each crRNA targeting a specific site is only a few dozen bases, and the entire carrier is small. Compared with ZFN and TALEN vectors, which are easier to construct (Research progress of CRISPR / Cas9 new gene targeting system. Journal of Jiangsu Agricultural Science. Li Hui et al., 2013). [0003] (CRISPR) / CRISPR-associated (Cas) is a continuously ev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11C40B40/08
Inventor 赵金山李和刚柳楠程明刘开东刘积凤
Owner QINGDAO AGRI UNIV