Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel plant fertility regulation structure and application thereof

A technology for constructs and plants, which is applied in the directions of plant products, plant genetic improvement, and botanical equipment and methods, can solve the problems of low purity of hybrids, low utilization rate of germplasm resources, and plant hybrid breeding technology needs to be improved.

Inactive Publication Date: 2014-05-21
FRONTIER LAB OF SYST CROP DESIGN CO LTD
View PDF4 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Commonly used hybrid breeding in rapeseed is also based on two types of cytoplasmic sterility and nuclear sterility, and there are "three-line" and "two-line" hybrid breeding. Therefore, as in rice, there are the same low utilization of germplasm resources, hybridization low purity problem
[0006] Therefore, the current plant hybrid breeding technology still needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel plant fertility regulation structure and application thereof
  • Novel plant fertility regulation structure and application thereof
  • Novel plant fertility regulation structure and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Example 1: Construction of rice fertility regulation vector

[0086] By assembling the following DNA elements, construct figure 1 The expression vector known as pZN1 is shown:

[0087] The first step: artificially synthesize the LTP2::RFP::PINII sequence, the DNA sequence of which is shown in SEQ ID NO:1. The artificially synthesized Pin II-RFP(2SNP)-ltp2 sequence was amplified by PCR, and the amplification primers were:

[0088] F1: CTT CGCATTCGCAAAACACACCTAGAC; the restriction endonuclease Nae I digestion site is in the box;

[0089] R1: CAA ATTGCAGTAC AACCGTCTCTTCGTGAGAATAACCG, the Pme I and Asc I cleavage sites are in the box, respectively.

[0090] The amplified Pin II-RFP(2SNP)-ltp2 fragment (SEQ ID NO: 1) was sequenced correctly, and then used Nae I and Pme I

[0091] Double-enzyme cut into the pCAMBIA1300 plasmid digested by Xmn I and Pme I, and the intermediate vector 1 is obtained if the identification is correct.

[0092] Step 2: Amplify cyp1 and c...

Embodiment 2

[0101] Example 2: Obtainment of maintainer line, propagation and production and principle of sterile line

[0102] Through design and verification, the present invention provides a method for constructing a rice maintainer line and further producing a male sterile line. According to an embodiment of the present invention, refer to image 3 , the method includes:

[0103] The first step: the construct described in Example 1 (containing the fertility restoration gene and the color selection gene expression cassette) was introduced into the rice homozygous recessive male sterile plant (ms26 / ms26) by genetic transformation to obtain the extracellular matrix. The T0 generation rice plants of the source gene can produce fertile male gametes, and the foreign genes of the T0 generation transgenic plants are in a heterozygous state ( Figure 3-1 );

[0104]In the second step, the T0 generation transgenic plants obtained in the first step are cultivated, and the seeds of the obtained...

Embodiment 3

[0108] Example 3: Rice Transformation

[0109] The plasmid pZN1 was transformed into the Agrobacterium AGL0 strain by the heat shock method, and the rice was co-transformed by the Agrobacterium-mediated method. The specific transformation receptor material was the complete male sterile homozygous mutant of rice ms26 / ms26. About this material For detailed description, see Chinese Patent CN200910309083.1 and The Plant Cell Vol.22:173-190, January 2010, the materials are currently available to the public, and these two documents are incorporated herein by reference. The rice transgenic material of pZN1 vector was obtained through the process of genetic transformation.

[0110] It should be noted that, a conventional gene knockout method can also be used to knock out all or part of the rice Ms26 gene to obtain a rice ms26 / ms26 complete male sterile homozygous mutant.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant breeding, and particularly relates to the fertility restoration of a homozygous recessive genic male sterility rice plant. Furthermore, the invention relates to a method for establishing a plant male sterile line and a maintainer line and a genetic transformation material, and more particularly relates to a structure, a rice cell, tissue or organ, a method for establishing a rice male sterile line and a maintainer line, a method for restoring the male fertility of a rice sterile plant, a method for preparing rice seeds, a genetic transformation material, a method for preparing hybrid rice and an application of the rice male sterile line in preparation of hybrid rice.

Description

technical field [0001] The present invention relates to the field of plant breeding. In particular, the present invention relates to fertility restoration of homozygous recessive GM male sterile rice plants and uses thereof. Further the present invention relates to methods for constructing plant male sterile lines, maintainer lines and genetic transformation materials, more particularly, the present invention relates to a construct, a rice cell, tissue or organ, a method for constructing a rice male sterile line and A method for maintaining a line, a method for restoring male fertility of a sterile rice plant, a method for preparing rice seeds, a genetically transformed material, a method for preparing hybrid rice, and a method for preparing a rice male sterile line Use in hybrid rice. Background technique [0002] Hybrid breeding is the main way of breeding new varieties and the most important method of breeding in modern times. The creation, utilization and industrializa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84A01H1/02A01H5/00
Inventor 唐晓艳王海洋周君莉
Owner FRONTIER LAB OF SYST CROP DESIGN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com