Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of anti-p21ras protein single-chain antibody and its application

A single-chain antibody and protein technology, applied in the field of medical biology, can solve the problems of long half-life, high toxicity, weak vascular permeability, etc., achieve high specificity and affinity, high specificity and affinity, and reduce the cost of the preparation process Effect

Active Publication Date: 2017-06-09
成都军区昆明总医院
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to the large molecular weight, weak vascular permeability, poor ability to diffuse into tumors, long half-life and high toxicity, intact antibodies used for tumor biotherapy limit their targeted delivery and tumor antagonism application effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of anti-p21ras protein single-chain antibody and its application
  • A kind of anti-p21ras protein single-chain antibody and its application
  • A kind of anti-p21ras protein single-chain antibody and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Preparation of single-chain antibody gene fragments

[0042] 1. Immunization of Balb / c mice with p21ras protein: Take 5 Balb / c mice aged 6-8 weeks (purchased from the Experimental Animal Center of Chongqing Third Military Medical University), and inject 100 μg of the prokaryotic Express the purified p21ras-K protein (for the preparation method of p21ras-K protein, refer to the paper "Expression, Identification and Purification of Recombinant p21ras Protein and Preparation of Polyclonal Antibody"), add an equal amount of complete Freund's adjuvant for the initial injection, Inject subcutaneously at 5 points. Two weeks later, the second injection was given, with the same dose as the first injection, plus an equal amount of incomplete Freund's adjuvant, and injected subcutaneously at 5 points. Two weeks later, the third injection was given, the dose was the same as the first one, without adjuvant, intraperitoneal injection. The fourth injection was given two w...

Embodiment 2

[0050] Example 2: Establishment and screening and identification of single-chain antibody library

[0051] 1. Construction of recombinant phagemid

[0052] 1.1 Double enzyme digestion of the recombinant pMD-ScFv vector and expression vector: extract the plasmid from the positive pMD-ScFv clone identified by PCR, and follow the instructions of Tiangen Plasmid Extraction Kit for the extraction steps. Recombined pMD-ScFv plasmid and expression vector plasmid pCANTAB-5E (purchased from Pharmacia Company) were digested with Sfi I respectively, and 30 μl of expression vector plasmid / pMD-ScFv vector were added to 200 μl PCR reaction tube respectively; Sfi I enzyme ( 10U / μl) 4μl; 10×Buffer M5μl, ddH 2 O11μl, after the above system is configured, react at 50°C for 4 hours. After gel recovery and purification of the digested product, add 30 μl of the purified product, 2 μl of Not I enzyme (10U / μl), 5 μl of 10×Buffer H, 2 μl of BSA, 2 μl of TrionX-1000, ddH into a new 200 μl PCR reacti...

Embodiment 3

[0064] Example 3: Construction of intracellular antibodies and inhibition experiments on tumor cells

[0065] 1. Construction of recombinant adenovirus vector

[0066] 1.1 Construction of the recombinant shuttle plasmid pShuttle-ScFv: the pMD-ScFv recombinant plasmid connected with the single-chain antibody coding gene was used as a template, and forward primers (5'-GA AGATCT CCGGACATGGACCAGGTGAA-3') and reverse primer (5'-CC CTCGAG ACCTAGCGCGTCTGCGGCTG C-3') amplifies the single-chain antibody gene fragment. The amplified PCR product was subjected to 1% agarose gel electrophoresis, and a DNA purification and recovery kit was used to recover and purify the target band with a size of 780 bp. Use Bgl II and Xho I to simultaneously double-digest the PCR product and the shuttle plasmid pShuttle-IRES-hrGFP-1 (purchased from Stratagene), respectively, and check whether the enzyme digestion is complete by 1% agarose electrophoresis, and use the Tiangen DNA Purification Kit to cut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a single-chain antibody and its application in inhibiting human tumor cells highly expressing p21ras protein. The gene fragment of the single-chain antibody is constructed by linking the light and heavy chain variable region gene fragments of mouse spleen B lymphocytes immunized with p21ras protein through a flexible oligonucleotide chain (Linker). Soluble expression of the above-mentioned single-chain antibody was performed, and experiments such as ELISA and immunohistochemistry confirmed that the single-chain antibody has the characteristics of broad-spectrum recognition, strong specificity, and high affinity for the three p21ras proteins. The intracellular antibody constructed by using the single-chain antibody can inhibit the proliferation and invasion ability of human tumor cells highly expressing p21ras protein, and can inhibit the growth of transplanted tumors of human tumor cells highly expressing p21ras protein in mice. It is proved that the single-chain antibody can be used to construct small molecule antibodies such as intracellular antibodies, which provides a new way for the treatment research of related tumors.

Description

technical field [0001] The invention belongs to the field of medical biology, and in particular relates to a broad-spectrum anti-p21ras protein single-chain antibody and the application of the antibody in the diagnosis and treatment of tumors related to the p21ras gene. Background technique [0002] The ras gene is an important cell proto-oncogene, and its name comes from the English rat asrcoma of rat sarcoma. The ras gene family includes three main members, namely H-ras, K-ras, and N-ras, which are located on chromosomes 12, 11, and 1, respectively, and encode a protein with a molecular weight of about 21KD consisting of 188-189 amino acids. Namely p21ras protein, the amino acid sequences of the three p21ras proteins have about 85% homology. [0003] As an important signal transduction protein, p21ras protein regulates the normal differentiation and proliferation of cells. After the p21ras protein is synthesized, its carboxyl terminal must undergo complex post-translatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/32C12N15/13C12N15/70A61K39/395A61P35/00
Inventor 杨举伦甄时建刘杜先胡奇婵周云刚陈玥
Owner 成都军区昆明总医院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com