Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transcription factor capable of being used to adjust plant traits

A technology for plant traits and plant seeds, which is applied in the fields of biotechnology and botany and can solve problems such as difficult to achieve

Inactive Publication Date: 2014-08-06
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] With the continuous deepening of genetic engineering research, more new genes can be cloned and transgenic technology will be further improved, and it will become possible to perform directional operations on multiple genes, which is difficult to achieve in conventional genetic improvement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transcription factor capable of being used to adjust plant traits
  • Transcription factor capable of being used to adjust plant traits
  • Transcription factor capable of being used to adjust plant traits

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0183] Embodiment 1, the isolation of gene, vector construction and transgenic method

[0184] Gene isolation and vector construction

[0185] The S1ZFP2 gene was isolated from the tomato line LA1589 (Solanum pimpinefolium). Utilize the total RNA extracted by Trizol to synthesize cDNA through reverse transcriptase, first use primers XP0034: 5'-ATGTTCAGATTACGCTCTCGAGATGAGTTATGAACCAAACACGG-3' and XP0036: CGGGATCCAACATAATCGCCCTTGAGTAGA to amplify the SlZFP2 coding sequence, clone into pMD18-T vector (purchased from Takara Company), and then Then XP0035: GCCACCATGGTTTACCCATACGATGTTCCAGATTACGCTCTCGAG and XP0036 were used to amplify the target fragment from the above sequenced correct plasmid, and the PCR product was connected to the pMD18-T vector. Primer XP0035 contains HA tag sequence and is used to construct HA-SlZFP2 fusion protein. After the sequencing was confirmed to be correct, the HA-SlZFP2 fragment was excised with the restriction endonuclease BamHI, and connected to th...

Embodiment 2

[0195] Embodiment 2, SlZFP2 gene expression characteristics and subcellular localization

[0196] 1. Gene expression characteristics

[0197] Using the DNA sequence of SlZFP2, the expression of SlZFP2 in different tissues was detected by in situ hybridization in LA1589 plants, a wild relative of tomato. For the method, see references Coen, E.S., et al., Cell, 1990.63(6):p.1311-22.

[0198] The result is as image 3 . It indicated that SlZFP2 was mainly expressed in young leaves (A), lateral buds (B), flower primordia (D), anthers and ovules (F), seeds (G and H).

[0199] 2. Subcellular localization of SlZFP2

[0200] Fluorescent protein gene YFP comes from Clontech Company, and the construction of the control vector p35S:YFP is to clone the YFP gene into pHX20 through PCR amplification, and the p35S:SlZFP2-YFP fusion expression vector is to amplify the full-length coding sequence of SlZFP2 by PCR NotI digestion and connection to p35S: YFP YFP sequence upstream correspondi...

Embodiment 3

[0202] Embodiment 3, overexpression and expression suppress the phenotype in tomato plant type, fruit and seed

[0203] 1. Analysis of phenotypic changes in tomato roots and fruits

[0204] Transgenic tomato was prepared as in Example 1, and the phenotypes of SlZFP2 overexpression and suppressed expression in plant type, fruit and seed were observed. Such as Figure 4 , except H in the figure is from the M82 transgenic line, the rest are from the LA1589 transgenic line. OE represents the overexpressed SlZFP2 plants transformed from plasmid pWL007, and the RNAi is the SlZFP2 expression suppressed plants derived from pWL009. #102, 103, 104 and 105 are plants from four independent transformation sources, and they are called lines after being homozygous. For each strain, the maturity changes of 15-20 fruits on 5 strains and the seed weight in 10 fruits were counted systematically, and the data were the mean ± standard deviation of 5 strains. The results showed that overexpress...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a transcription factor capable of being used to adjust plant traits. The plant shape, the blossom period, and the mature time and size of the harvest organs such as fruits are prominently improved through changing the expression of the transcription factor in plants. Thus the transcription factor can be used to create plants with ideal traits.

Description

technical field [0001] The invention belongs to the fields of biotechnology and botany; more specifically, the invention relates to a transcription factor that can be applied to regulate plant traits. Background technique [0002] Under natural circumstances, the frequency of gene spontaneous or induced mutations is low, and beneficial mutations are even less; moreover, the available germplasm resources of a certain plant are limited to a very limited range due to the constraints of reproductive isolation and other characteristics, making plants Genetic improvement has been largely limited. In the current prior art, plant genetic improvement is based on gene mutation and sexual hybridization. [0003] With the development of molecular biology, people have explored and studied the introduction of exogenous genes into cells and the regeneration of transformants after introduction into cells, and established a feasible genetic transformation system, making plant genetic engine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/29C12N15/113C07K14/415A01H5/00
Inventor 肖晗翁林
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com