Method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA
A male sterility, cytoplasmic technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of sterile plants, difficult to distinguish, affecting the commercial breeding of soybean CMS, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] The selected four pairs of SNPs markers of chloroplast DNA are named SNP1, SNP2, SNP3 and SNP4 respectively.
[0057] The partial flanking sequence corresponding to SNP1 is:
[0058] ACGGTAGTATTAGGAGCTAC[C / T]([Sterile Cytoplasm / Fertile Cytoplasm])TTAGCTATTGCTCAACAAGA;
[0059] The partial flanking sequence corresponding to SNP2 is:
[0060] AGATAGATATCTATAGTTAT[A / C]([Sterile Cytoplasm / Fertile Cytoplasm])AATTTTTGTTTGTTGTCCCC;
[0061] The partial flanking sequence corresponding to SNP3 is:
[0062] ACAATTAGATTAGACAATTA[T / G]([Sterile Cytoplasm / Fertile Cytoplasm])AAAAAAATATTGAGACAATT;
[0063] The partial flanking sequence corresponding to SNP4 is:
[0064] TAAATTTCTATATTAGAATT[C / A] ([Sterile Cytoplasm / Fertile Cytoplasm]) TATTTTTTTTAGAAAGCCTC.
[0065] The identification materials are the male sterile line of soybean cytoplasm (containing male sterile cytoplasm) and its matching maintainer line (containing male fertile cytoplasm) (provided and preserved by Soybean Ins...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


