Method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA

A male sterility, cytoplasmic technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of sterile plants, difficult to distinguish, affecting the commercial breeding of soybean CMS, etc.

Active Publication Date: 2014-08-27
JILIN ACAD OF AGRI SCI
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Such seeds are planted in production, which will inevitably lead to sterile plants in the production field and reduced production
[0004] The current molecular marker method for identifying soybean male sterile cytoplasm is based on the difference in the size of PCR amplified fragments of base deletions (indels) to distinguish soybean RN-type cytoplasmic sterile lines and maintainer lines, and the amplified fragments in the sterile lines and The size difference in the maintainer line is only 12bp, which must be distinguished by high-concentration 3% agarose gel electrophoresis, which may not be easy to distinguish in practice, and a single marker may affect the soybean male sterile cytoplasm and normal fertile cytoplasm The accuracy of identification, which in turn affects the commercial breeding of soybean CMS

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA
  • Method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] The selected four pairs of SNPs markers of chloroplast DNA are named SNP1, SNP2, SNP3 and SNP4 respectively.

[0057] The partial flanking sequence corresponding to SNP1 is:

[0058] ACGGTAGTATTAGGAGCTAC[C / T]([Sterile Cytoplasm / Fertile Cytoplasm])TTAGCTATTGCTCAACAAGA;

[0059] The partial flanking sequence corresponding to SNP2 is:

[0060] AGATAGATATCTATAGTTAT[A / C]([Sterile Cytoplasm / Fertile Cytoplasm])AATTTTTGTTTGTTGTCCCC;

[0061] The partial flanking sequence corresponding to SNP3 is:

[0062] ACAATTAGATTAGACAATTA[T / G]([Sterile Cytoplasm / Fertile Cytoplasm])AAAAAAATATTGAGACAATT;

[0063] The partial flanking sequence corresponding to SNP4 is:

[0064] TAAATTTCTATATTAGAATT[C / A] ([Sterile Cytoplasm / Fertile Cytoplasm]) TATTTTTTTTAGAAAGCCTC.

[0065] The identification materials are the male sterile line of soybean cytoplasm (containing male sterile cytoplasm) and its matching maintainer line (containing male fertile cytoplasm) (provided and preserved by Soybean Ins...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA. The method can also be applied to distinction of a soybean cytoplasmic male sterile line and a maintainer line containing normal cytoplasm. The method includes the following steps of extracting the seed genome DNA of the soybean cytoplasmic male sterile line and the seed genome DNA of the maintainer line to serve as amplification templates, selecting four pairs of the SNPs marks of the chloroplast DNA, and designing a pair of primers on the side wing sequences of each pair of SNPs respectively to conduct PCR amplification. The PCR products obtained through amplification conduct identification on the difference between the length of the enzyme-digested products of the sterile line and the length of the enzyme-digested products of the maintainer line through digestion of restriction enzymes. According to the method, the soybean male sterile cytoplasm and normal fertile cytoplasm can be rapidly and accurately identified. The method can also be used for detecting the maintainer line which contains fertile cytoplasm and is mixed in the sterile line containing sterile cytoplasm in the breeding process of the sterile line, and provides guarantees for the purity requirement in the production process of soybean sterile line seeds.

Description

technical field [0001] The invention provides a method for identifying soybean male sterile cytoplasm by SNP marker of chloroplast DNA, which is used for identifying soybean male sterile cytoplasm and normal fertile cytoplasm, and can also be used to distinguish soybean cytoplasmic male sterile lines from sterility during seed production A paternal maintainer line (containing fertile cytoplasm) mixed into a line (containing sterile cytoplasm) belongs to the technical field of molecular marker detection. Background technique [0002] Soybean cytoplasmic male sterility (cytoplasmic male sterility, CMS) "three lines" consists of a sterile line, a maintainer line and a restorer line. The carrier of the male sterile cytoplasm is the sterile line, while the carrier of the male fertile cytoplasm is the maintainer line. The Jilin Academy of Agricultural Sciences first bred soybean CMS "three lines". CMS is widely used in the utilization of crop heterosis. Its biggest advantage is t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2531/113C12Q2521/301C12Q2565/125
Inventor林春晶张春宝董英山赵丽梅彭宝赵洪锟
OwnerJILIN ACAD OF AGRI SCI