Construction and breeding method of high-sugar resistant baker's yeast strain

A baker's yeast and baker's yeast technology, which is applied in the field of bioengineering, can solve the problems of inhibiting the growth rate and fermentation performance of yeast, affecting cell activity, and low dough gas production, reducing osmotic pressure inhibition and glucose effect, and being difficult to reverse mutation. , to promote the effect of promotion and application

Active Publication Date: 2017-03-15
TIANJIN UNIV OF SCI & TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in high-sugar dough, the SUC gene family hydrolyzes sucrose more than 300 times faster than yeast utilizes hexose, causing cells to accumulate a large amount of hexose hydrolyzed by invertase but not utilized in a short period of time, which in turn leads to yeast The surrounding environment forms a high osmotic pressure, which directly affects the activity of the cells. At the same time, excessive glucose accumulation will cause the glucose effect, thereby inhibiting the growth rate and fermentation performance of the yeast, resulting in low gas production in the dough and slow fermentation speed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and breeding method of high-sugar resistant baker's yeast strain
  • Construction and breeding method of high-sugar resistant baker's yeast strain
  • Construction and breeding method of high-sugar resistant baker's yeast strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Embodiment 1: the construction of the baker's yeast strain suitable for high-sugar dough fermentation

[0073] The construction process of recombinant strains is as follows: figure 1 shown.

[0074] The diploid starting strain CICC32253 was haploidized to generate a-type and α-type haploid strains 70a and 24α, and the recombinant haploid strains were constructed by two homologous recombination methods, and then the KanMX resistance gene was removed and the recombinant single Ploid strains to generate diploid recombinant strain BS-2.

[0075] (1) Construction of recombinant plasmid pUC-AKPB

[0076] The construction process of the recombinant plasmid pUC-AKPB is as follows: image 3 shown.

[0077] ① Using the total DNA of the yeast strain CICC32253 as a template, the VPS8 promoter fragment VPS8p was amplified by PCR;

[0078] Upstream primer Vp1:CG GGATCC TGTCACTCTAGATGTCAAGCC (SEQ ID NO: 3)

[0079] The underlined part is the enzyme cleavage site;

[0080] Dow...

Embodiment 2

[0136] Embodiment 2: Fermentation experiment of baker's yeast strain suitable for high-sugar dough fermentation

[0137] (1) Fermentation experiments of transformants and haploid parents

[0138] The haploid parents 70a and 24α and their corresponding recombinant haploid strains were simultaneously fermented with high-sugar dough, fresh yeast 9g, NaCl2. Dissolved in distilled water at ℃, mixed evenly and poured into 280g flour (the same below), and the fermentation performance and sucrase enzyme activity of the strain were measured. The results are shown in Table 1. The results showed that the haploid parent 70a was 2h CO in dough fermentation 2 The production volume is 645mL, the sucrase enzyme activity is 40.83U / g dry yeast, and the corresponding recombinant haploid strain is 2h CO in the dough fermentation 2 The production volume is 705mL, the sucrase enzyme activity is 34.25U / g dry yeast, that is, the dough of recombinant haploid a-VPS8p is fermented for 2h CO 2 Compare...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a saccharomyces cerevisiae strain suitable for fermenting high-sugar dough and a construction method of the saccharomyces cerevisiae strain. The saccharomyces cerevisiae strain disclosed by the invention is obtained by regulating and controlling a sucrose encoding gene SUC2 in an original strain saccharomyces cerevisiae CICC32253 through using a VPS8 promoter. Compared with a parent strain, a high-sugar dough fermentation capability of the saccharomyces cerevisiae strain is obviously improved and the CO2 production amount is 875mL when the high-sugar dough is fermented for two hours; compared with the parent strain, the fermentation capability is improved by 10.06% and the fermentation time is shortened by eight minutes; and the technical obstacles and the quality defects in a sweet bread making process are solved, and the bred saccharomyces cerevisiae strain has no special requirements on fermentation equipment and conditions and can be used by equipment and conditions of common factories, so that the saccharomyces cerevisiae strain has a wide application prospect.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and relates to the breeding of industrial microorganisms, in particular to a baker's yeast strain suitable for high-sugar dough fermentation and a construction method thereof. Background technique [0002] Baker's yeast is an important microbial leavening agent and leavening agent in the bread production process, and it is also a biological nutrient that can increase the nutritional content of dough. Generally, baker's yeast is divided into two categories: one is low-sugar baker's yeast, which is used in dough with no added sugar or less than 7% sugar; the other is high-sugar baker's yeast, which is used in high-sugar dough fermentation. High-sugar baker's yeast is mainly used in the production of sweet bread. Sweet bread is traditionally called dim sum bread in my country. Beautiful and attractive, giving people a beautiful enjoyment, especially the sweet bread with various fillings is dif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/18C12N15/81C12Q1/68C12Q1/04A21D8/04C12R1/865
Inventor张翠英肖冬光封冰董健杜丽萍陈叶福
OwnerTIANJIN UNIV OF SCI & TECH