Primers, kit and preparation method for detecting vesicular stomatitis virus
A technology of vesicular stomatitis and detection kits, which can be used in biological testing, measuring devices, material inspection products, etc., and can solve problems such as high risk factors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0018] The present invention will be explained in detail below in conjunction with the examples.
[0019] 1. Preparation of Sequences
[0020] According to the requirements of GeXP primer design and the genome of VSV published by NCBI, select the conserved region to design specific primers, and form specific chimeric primers by adding universal primers, while the universal primer sequences belong to non-biological nucleotide sequences, and synthesize Universal primer sequence, and a Cy5 fluorescent tag is added to the 5' end of the upstream universal primer. The obtained primer sequences are: SEQ ID No.1: AGGTGACACTATAGAATATGATACAGTACAATTATTTTGGGA, which is named VSV-F in the present invention; SEQ ID No.2: GTACGACTCACTATAGGGAGAGACTTTCTGTTAGGGATCTGG, which is named VSV-R in the present invention. Universal primers used in the present invention: SEQ ID No. 3: Cy5AGGTGACACTATAGATA, named UWD-F in the present invention; and SEQ ID No. 4: GTACGACTCACTATAGGGA, named UEV-R in the p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
