Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant adeno-associated virus and preparation method and application thereof

A virus and targeting technology, applied in the field of recombinant adeno-associated virus, can solve the problem of lack of effective drug targets to specifically kill tumor cells, etc., and achieve the effects of simple preparation method, high preparation efficiency and strong safety

Inactive Publication Date: 2015-03-11
天津迈拓思生物科技有限公司
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the targeted therapy of tumors faces great challenges, mainly due to the lack of effective drug targets for specifically killing tumor cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adeno-associated virus and preparation method and application thereof
  • Recombinant adeno-associated virus and preparation method and application thereof
  • Recombinant adeno-associated virus and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] A recombinant adeno-associated virus of this embodiment is prepared according to the following steps:

[0032] 1. Design specific human RRP15 RNAi targeting sequence: design the 74th to 93rd bases of the human RRP15 siRNA targeting sequence (aaatggtaactggagccgta);

[0033] 2. Chemical synthesis of the following primers:

[0034] Primer 1: 5’-GATTC aaatggtaactggagccgta A-3’,

[0035] Primer 2: 5’-AGCTT tacggctccagttaccattt G-3’;

[0036] 3. Primer annealing in step 2: Add 10μM primer 1 and primer 2 to T4 ligase buffer, incubate at 95°C for 5 minutes, place at room temperature, and slowly cool to room temperature;

[0037] 4. Use restriction enzymes EcoR I and Hind IIII to digest the adenovirus vector pAAV-GFP, and recover the digested fragments;

[0038] 5. Use T4 DNA ligase to ligate the above DNA fragments at room temperature to obtain pAAV-GFP-shRRP15;

[0039] 6. Use the pAAV-GFP-shRRP15 prepared in step 5 and the helper vector plasmid to co-transfect 293T cells;

[0040] 7. Cells...

Embodiment 2

[0044] A recombinant adeno-associated virus of this embodiment is used to prepare an injection for anti-cervical cancer, which is prepared according to the following steps:

[0045] The high-titer virus solution after virus amplification prepared in Example 1, filtered through a 0.2μm pore filter membrane, diluted with normal saline (0.9% sodium chloride aqueous solution) at a volume ratio of 1:100, and divided into 1ml / Ampoule, sealed, stored at 4°C.

[0046] The titer of the recombinant adeno-associated virus prepared in Example 2 was determined by the well-dilution titer assay method:

[0047] 1) Cell preparation: inoculate 100μl HEK-293 cells in a 96-well plate, the number of cells per well is about 1×10 5 Each was cultured in DMEM medium containing 2% serum.

[0048] 2) Preparation of diluted virus solution: Dilute the virus solution to 8 concentrations with 2% DMEM (such as 10 -1 -10 -8 ), each concentration was repeated 10 times, and 100 μl virus dilution was added to each wel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention relates to a recombinant adeno-associated virus and a preparation method and application thereof, relates to a virus introducing foreign gene modified materials and a preparation method and application thereof, particularly relates to the recombinant adeno-associated virus and the preparation and application thereof, and aims to provide the recombinant adeno-associated virus capable of specifically killing tumor cells, and a preparation method and application thereof. The recombinant adeno-associated virus has the advantages of high titer, high safety and convenient use; the preparation method of the recombinant adeno-associated virus has the advantages of being simple in preparation, high in preparation efficiency and capable of large amount of amplification for large-scale production; an injection preparation against cervical cancer can be efficient in infection of cervical cancer cells, and has no killing effect on normal cells. The recombinant adeno-associated virus is used in the field of the injection preparation against cervical cancer.

Description

Technical field [0001] The invention relates to a virus introduced with foreign gene modification materials, a preparation method and application thereof, and in particular to a recombinant adeno-associated virus, a preparation method and application thereof. Background technique [0002] Cervical cancer is one of the common gynecological malignancies, and its incidence ranks second among female malignancies. According to worldwide statistics, there are an estimated 466,000 new cases of cervical cancer each year, of which nearly 100,000 new cases are estimated in China, accounting for about 1 / 5 of the total number of new cases in the world, and about 30,000 women die each year. Cervical cancer. In recent years, although certain progress has been made in the treatment of cervical cancer, the overall effect is not good, and the fatality rate is still high. The reason is that people at this stage still lack specificity based on the understanding of the development mechanism of cerv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01A61K35/761A61P35/00
Inventor 朱长军姜伟董智雄
Owner 天津迈拓思生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com