Compositions and methods comprising sequences having meganuclease activity

A technology of meganuclease and nucleotide sequence, applied in the field of molecular biology

Inactive Publication Date: 2015-03-11
EI DU PONT DE NEMOURS & CO +1
View PDF105 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although both systems have provided techniques available for the targeted insertion of sequences of interest, there remains a need for nucleases that facilitate the precise engineering of plant or yeast genomes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods comprising sequences having meganuclease activity
  • Compositions and methods comprising sequences having meganuclease activity
  • Compositions and methods comprising sequences having meganuclease activity

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0894] Maize Embryo Transformation

[0895] Transformation can be accomplished by various methods known to be effective in plants, including particle-mediated delivery, Agrobacterium-mediated transformation, PEG-mediated delivery, and electroporation.

[0896] a. Particle-mediated delivery

[0897] Transformation of immature maize embryos using particle delivery was performed as follows. The medium recipe follows the following.

[0898] Ears were dehulled and surface sanitized in 30% Clorox bleach plus 0.5% Micro detergent for 20 minutes, then rinsed twice with sterile water. The immature embryos were separated and placed with the hypocotyl side down (cotyledon disc side up), 25 embryos per plate, cultured on 560Y medium for 4 hours, and then aimed at the 2.5cm target area to prepare for bombardment. Alternatively, placed on 560Y at 26°C for 4 hours prior to bombardment as described above, prior to placing isolated embryos on 560L (induction medium) at a temperature fro...

example 2

[0913] Transient expression of BBM-enhanced transformation

[0914] Parameters of the transformation protocol can be modified to ensure that BBM activity is transient. One such method involves precipitating a BBM-containing plasmid in a manner that permits transcription and expression, but precludes subsequent DNA release, for example by chemical PEI.

[0915] In one example, the BBM plasmid was precipitated on gold particles with PEI, and the transgene expression cassette to be integrated (UBI::moPAT-GFPm::PinII; moPAT is a maize-optimized PAT gene) was deposited on gold particles.

[0916]Briefly, gold particles were coated with PEI as follows. First, the gold particles are washed. Weigh 35 mg of gold particles, average diameter (A.S.I. #162-0010) 1.0 in a microcentrifuge tube, add 1.2 ml of absolute ethanol and vortex for 1 minute. The centrifuge tubes were incubated at room temperature for 15 minutes and then centrifuged at 4°C for 15 minutes at high speed using a mi...

example 3

[0921] DNA shuffling to create variants of the LIG3-4 meganuclease

[0922] A. LIG3-4 meganuclease and LIG3-4 recognition sequence

[0923] An endogenous maize genome target site (SEQ ID NO: 2) containing the LIG3-4 recognition sequence was selected for the design of custom double-strand break inducers. The LIG3-4 recognition sequence is a 22bp polynucleotide having the following sequence: ATATACCTCACACGTACGCGTA (SEQ ID NO: 2).

[0924] The wild-type l-Crel meganuclease (SEQ ID NO: 3) was modified as described in US Patent Publication 2009-0133152A1 to produce a LIG3-4 meganuclease designed to recognize the LIG3-4 recognition sequence. The wild-type l-Crel meganuclease is a homodimer. To recognize the LIG3-4 recognition sequence, different substitutions were made for each monomer and for each monomer, the coding sequence was linked with a linker sequence to make a single chain fusion polypeptide (LIG3-4, SEQ ID NO: 1).

[0925] B. Creation of LIG3-4 meganuclease varia...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Compositions and methods comprising polynucleotides and polypeptides having meganuclease activity are provided. Further provided are nucleic acid constructs, yeast, plants, plant cells, explants, seeds and grain having the meganuclease sequences. Various methods of employing the meganuclease sequences are provided. Such methods include, for example, methods for producing a meganuclease with increased activity at a wide range of temperatures, methods for producing a yeast, plant, plant cell, explant or seed comprising a meganuclease with increased activity.

Description

[0001] This application claims the benefit of US Provisional Application 61 / 642470, filed May 4, 2012, and US Provisional Application 61 / 683765, filed August 16, 2012; both of which are incorporated herein by reference in their entirety. technical field [0002] The present invention relates to the field of molecular biology. More specifically, the invention relates to sequences having meganuclease activity. Background technique [0003] Through recombinant DNA technology, foreign DNA sequences are readily inserted into the genome of an organism, thereby altering the phenotype of said organism. The most commonly used methods of plant transformation are Agrobacterium infection and biolistic particle bombardment, in which transgenes integrate into the plant genome in a random pattern and with unpredictable copy numbers. Therefore, researchers are working to control the integration of transgenes in plants. [0004] Site-specific integration techniques (using position-specific...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N15/82
CPCC12N15/8213C12N9/16C12N9/22C12N15/81C12Y301/00
InventorE.伯穆德兹A.M.西甘J.恩格里斯S.C.发科H.高L.刘Z-B.刘A.安格S.斯维塔舍夫J.K.杨
OwnerEI DU PONT DE NEMOURS & CO