Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific primers and probes for the detection of the A:G mutation at site 2064 of Mycoplasma pneumoniae 23s rRNA

A specific technology for Mycoplasma pneumoniae, applied in DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve problems such as unfavorable guidance of medication, difficulty in separation of Mycoplasma pneumoniae, time-consuming and labor-intensive, etc.

Active Publication Date: 2016-09-07
JIANGSU MOLE BIOSCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the clinical detection of drug resistance of Mycoplasma pneumoniae mainly relies on the isolation of Mycoplasma pneumoniae and drug sensitivity test. Because the separation of Mycoplasma pneumoniae is difficult, the sensitivity is low, and it is time-consuming and labor-intensive, which is not conducive to timely guidance of medication

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primers and probes for the detection of the A:G mutation at site 2064 of Mycoplasma pneumoniae 23s rRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0009] 1. Design of primers and probes: By comparing and analyzing all known 23S rDNA sequences of Mycoplasma pneumoniae, select the segment where the 2064 site is located, and design multiple pairs of primers and probes. The length of the primers is generally about 20 bases. The optimal primer-probe sequence combination is as follows:

[0010] Upstream primer MPF: 5’ GGTGTAACCATCTCTTGA 3’

[0011] Downstream primer MPR: 5’CCTGATCAATATTAAGCTACAG 3’

[0012] Probe 2064P: 5' FAM CGGGGTCTCTCCGTCC BHQ1 3'.

[0013] 2. Optimization of the reaction system: using clinically isolated drug-resistant Mycoplasma pneumoniae inactivation solution as the sample to be tested, the nucleic acid of Mycoplasma pneumoniae was extracted by magnetic bead lysis method, and stored at -80°C after aliquoting.

[0014] 2.1 Optimization of primer concentration In the case of the same other conditions in the reaction system, the concentration of Mycoplasma pneumoniae primers was serially diluted from 0....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific primer and probe for detecting A:G mutation on the mycoplasma pneumonia 23S rRNA 2064 locus, and belongs to the technical field of biology. The nucleotide sequence comprises an upstream primer MPF sequence: 5'GGTGTAACCATCTCTTGA3' and a downstream primer MPR sequence: 5'CCTGATCAATATTAACCTACAG3'. The probe 2064P sequence is 5'FAMCGGGGTCTCTCCGTCCBHQ13'.

Description

technical field [0001] The invention relates to a specific primer and a probe for detecting the A:G mutation of the 23S rRNA 2064 site of Mycoplasma pneumoniae. Background technique [0002] Mycoplasma pneumoniae( Mycoplasma pneumoniae , MP) is a common respiratory pathogen that usually causes mild upper respiratory tract infections such as sore throat, pharyngitis, and bronchitis, which account for 50% of nonbacterial pneumonia and can also cause extrapulmonary complications, Involvement of one or more systems and organs, such as skin, gastrointestinal tract, cardiovascular, skeletal muscle and kidney, can cause central and peripheral nervous system lesions and even death in severe cases. It spreads in the form of aerosol through droplets and stays in the nose, throat, trachea and sputum. Close contact may cause the outbreak of Mycoplasma pneumoniae. Mycoplasma pneumoniae has no cell wall and is not sensitive to antibiotics that affect cell wall synthesis, such as penicil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/35
CPCC12Q1/6858C12Q1/689C12Q2600/156C12Q2531/113C12Q2563/107
Inventor 杜君卿李杨霞
Owner JIANGSU MOLE BIOSCI