Specific primers and probes for the detection of the A:G mutation at site 2064 of Mycoplasma pneumoniae 23s rRNA
A specific technology for Mycoplasma pneumoniae, applied in DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve problems such as unfavorable guidance of medication, difficulty in separation of Mycoplasma pneumoniae, time-consuming and labor-intensive, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0009] 1. Design of primers and probes: By comparing and analyzing all known 23S rDNA sequences of Mycoplasma pneumoniae, select the segment where the 2064 site is located, and design multiple pairs of primers and probes. The length of the primers is generally about 20 bases. The optimal primer-probe sequence combination is as follows:
[0010] Upstream primer MPF: 5’ GGTGTAACCATCTCTTGA 3’
[0011] Downstream primer MPR: 5’CCTGATCAATATTAAGCTACAG 3’
[0012] Probe 2064P: 5' FAM CGGGGTCTCTCCGTCC BHQ1 3'.
[0013] 2. Optimization of the reaction system: using clinically isolated drug-resistant Mycoplasma pneumoniae inactivation solution as the sample to be tested, the nucleic acid of Mycoplasma pneumoniae was extracted by magnetic bead lysis method, and stored at -80°C after aliquoting.
[0014] 2.1 Optimization of primer concentration In the case of the same other conditions in the reaction system, the concentration of Mycoplasma pneumoniae primers was serially diluted from 0....
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 